Greetings to all CHIMERA Forum members / users / bug-fixers I am PhD student working on trying to identify F-box domains in plant proteomes, primarily via sequence based approaches like HMM profile based discovery. In order to build the profile HMM, I am building my seed alignment with the use of a structural alignment of solved crystal structures of human F-box proteins. Specifically, I seek some help from you or any of your lab members regarding what might possibly be a bug in your CHIMERA, and also help with protocol / parameter choice for both Matchmaker and Match->Align work I am doing. The PDBs trimmed to just the domain regions of my interest are attached as zipped folder #1. When I use default parameters for Matchmaker followed by default parameters for Match->Align, I obtain a multiple sequence alignment that appears well conserved except at the N and C terminals (based on RMSD track in the output EPS file) - However, for 2E31-A, the LW di-peptide (in the 2nd row of the alignment) is matched with the rest of the multipel sequence alignment. Please see attachment #2 - this mismatch in the MSA, is actually a structural match as seen via CHIMERA and PyMOL. So my *question #1* is how can I be sure that other residues have been accurately aligned in 3D and then accurately aligned in the 2D MSA? If this even an artifact, is it caused more by some error in my choice of methods / parameters or is this indeed a mis-alignment that should be all alignment LW at those two positions? (which is how it looked even in PyMol after structural superposition) And my *question #2* is what are the most appropriate parameters to be used for the purposes for my Match -> Align work? Should I use iteration for Matchmaker or not, if so how many or until convergence, if yes or otherwise, what should the residue RMSD not exceed? Should I retain it as the default 5A or do down to a conservative 1A instead? Thanks for any help in this regard. Sincerely, Anand -- Anand K.S. Rao PhD candidate Plant Biology Graduate Group President Indian Graduate Student Association @ UCDavis University of California at Davis Davis, CA - 95616 USA -------------------------------------------- CTTATTGTTGAACTTOAATGGTGCTAATGATCCTCGTOTCTCCTGAACGT (translate THAT!) -- Anand K.S. Rao PhD candidate Plant Biology Graduate Group President Indian Graduate Student Association @ UCDavis University of California at Davis Davis, CA - 95616 USA -------------------------------------------- CTTATTGTTGAACTTOAATGGTGCTAATGATCCTCGTOTCTCCTGAACGT (translate THAT!) -- Anand K.S. Rao PhD candidate Plant Biology Graduate Group President Indian Graduate Student Association @ UCDavis University of California at Davis Davis, CA - 95616 USA -------------------------------------------- CTTATTGTTGAACTTOAATGGTGCTAATGATCCTCGTOTCTCCTGAACGT (translate THAT!)
