July 2012 - Chimera-users - RBVI Mailing Lists

how do I open RMF files in chimera on Mac?
by Khuri, Natalia 26 Jul '12

26 Jul '12

Natalia Khuri PhD Student, Graduate Group in Biophysics Laboratory of Andrej Sali UCSF MC 2552 Byers Hall Room 503B 1700 4th Street San Francisco, CA 94158-2330, USA

2 1

Doubt regarding cryeom map density threshold setting
by rakesh ramachandram 24 Jul '12

24 Jul '12

Hello, My name is Rakesh. I would like to know how to set the density threshold according to the molecular mass of the protein in the cryoem map. I would also like to know how to calculate the molecular mass of a particular segment after segmentation in cryoem map. Regards Rakesh Ramachandran PhD Student Molecular Biophysics Unit, Indian Institute of Science, Bangalore - 560012 India

2 5

thioester linkage between two protein
by Hamze Rahimi 24 Jul '12

24 Jul '12

Dear Expert I want defiend a thioester linkage between the C-terminal carboxyl group of G and the sulfhydral group of cysteine in the middle of other protein. Please let me know if there is such possibility in Chimera Best wish -- Hamzeh Rahimi PhD student in Medical Biotechnology INT-KIT,Karlsruhe

2 1

Radial color solid style map display
by Tom Goddard 23 Jul '12

23 Jul '12

Hi David, Radially coloring using solid style map display doesn't work. Solid style display of a single plane with volume viewer uses a gray-level coloring of the plane. The Surface Color tool and other coloring tools in Chimera replace the coloring of a surface and aren't able to modulate the existing (gray-level) coloring. But there are often tricky ways to get what you want. I've attached a picture of a radial color of a plane of an HIV tomogram. I did it by opening the map twice. With the first copy I display the solid style plane. With the second copy I display one plane in surface style with a low contour level. Then I placed a marker (volume tracer) at the center of a virus on that surface and used surface color to color that surface radially (scolor command). Then I made that surface transparent (command "transp 90 #1" in Chimera daily build). It didn't look good because the two planes were coincident which created artifacts, so I froze the first map (Model Panel, deactivate) and moved the second one a tiny bit in front. Also I made the background color gray -- black or white give somewhat different appearance. You could also layer a transparent radial colored layer on top in PhotoShop or Gimp I bet. Tom > Hi Tom, > I'm writing as I would like to color by radius an EM map but when it is displayed as a single plane of width=1 pixel. > Is this possible? > Thanks a lot > David > > David Veesler > Research Associate > The structural Virology lab - Johnson's lab > Department of Molecular Biology > The Scripps Research Institute > > >

1 0

CHIMERA clarification / mis-alignment?
by Anand K S Rao 21 Jul '12

21 Jul '12

Greetings to all CHIMERA Forum members / users / bug-fixers I am PhD student working on trying to identify F-box domains in plant proteomes, primarily via sequence based approaches like HMM profile based discovery. In order to build the profile HMM, I am building my seed alignment with the use of a structural alignment of solved crystal structures of human F-box proteins. Specifically, I seek some help from you or any of your lab members regarding what might possibly be a bug in your CHIMERA, and also help with protocol / parameter choice for both Matchmaker and Match->Align work I am doing. The PDBs trimmed to just the domain regions of my interest are attached as zipped folder #1. When I use default parameters for Matchmaker followed by default parameters for Match->Align, I obtain a multiple sequence alignment that appears well conserved except at the N and C terminals (based on RMSD track in the output EPS file) - However, for 2E31-A, the LW di-peptide (in the 2nd row of the alignment) is matched with the rest of the multipel sequence alignment. Please see attachment #2 - this mismatch in the MSA, is actually a structural match as seen via CHIMERA and PyMOL. So my *question #1* is how can I be sure that other residues have been accurately aligned in 3D and then accurately aligned in the 2D MSA? If this even an artifact, is it caused more by some error in my choice of methods / parameters or is this indeed a mis-alignment that should be all alignment LW at those two positions? (which is how it looked even in PyMol after structural superposition) And my *question #2* is what are the most appropriate parameters to be used for the purposes for my Match -> Align work? Should I use iteration for Matchmaker or not, if so how many or until convergence, if yes or otherwise, what should the residue RMSD not exceed? Should I retain it as the default 5A or do down to a conservative 1A instead? Thanks for any help in this regard. Sincerely, Anand -- Anand K.S. Rao PhD candidate Plant Biology Graduate Group President Indian Graduate Student Association @ UCDavis University of California at Davis Davis, CA - 95616 USA -------------------------------------------- CTTATTGTTGAACTTOAATGGTGCTAATGATCCTCGTOTCTCCTGAACGT (translate THAT!) -- Anand K.S. Rao PhD candidate Plant Biology Graduate Group President Indian Graduate Student Association @ UCDavis University of California at Davis Davis, CA - 95616 USA -------------------------------------------- CTTATTGTTGAACTTOAATGGTGCTAATGATCCTCGTOTCTCCTGAACGT (translate THAT!) -- Anand K.S. Rao PhD candidate Plant Biology Graduate Group President Indian Graduate Student Association @ UCDavis University of California at Davis Davis, CA - 95616 USA -------------------------------------------- CTTATTGTTGAACTTOAATGGTGCTAATGATCCTCGTOTCTCCTGAACGT (translate THAT!)

2 1

Box-beam protein sculptures
by Tom Goddard 19 Jul '12

19 Jul '12

Hi Dan, I added the "shape boxpath" command to Chimera to display box-beam protein backbones and output cut distances for making your physical models. http://collegenews.org/faculty-focus/2011/welding-art-and-science.html I've attached an example picture and command script that made that picture. More details, for example, how to get the cut distances is given in the Chimera feature/bug database: http://plato.cgl.ucsf.edu/trac/chimera/ticket/11191#comment:1 I have not tested the output cut distances so you should do some sanity checks with simple test cases before you trust those numbers. If you are curious about the code it is here http://plato.cgl.ucsf.edu/trac/chimera/browser/trunk/libs/Shape/boxpath.py The new command will be in tonight's Chimera daily builds. Here's a weird connection. These sculptural box beams may help display large molecules on cell phones! Cell phones have slow 3-d graphics and this square cross-section depiction would place minimal computational demands on the phone. Typical depictions with spheres and cylinders and smooth ribbons require a lot more computational power. Tom -------- Original Message -------- Subject: Re: Fwd: [Chimera-users] Texans: get to work! From: Daniel Gurnon To: Tom Goddard Date: 7/17/12 3:26 PM > Hi Tom, > Sorry for the delay- I was just about to email you when I discovered > your message. Missed it the first time somehow. Thanks for offering to > help. > > The key to the saw problem is doing it old-school: Julian > Voss-Andreae (the artist who came up with the idea of turning protein > backbones into miter-cut sculptures) showed me how to use a Japanese > pull-saw to make the cuts by hand. Besides being easier than setting > up a miter saw, the small kerf minimizes material loss. The distances > along the edges allow us to trace out the plane, and then you just > carefully cut along the line. > > When we did this in steel we used grinders to cut out each piece from > a box beam. It was a little more difficult than it was with wood, > because to make the welds look right we had to account for the > thickness of the material. > > And about the Euler angles- right, there would only be two in this > case. The third is what allows us to translate the 3D structure back > into a linear piece of material. As long as the material is > symmetrical, you can make the miter cuts and just flip every other piece. > > So as I mentioned in my earlier message, Julian's C++ program does > this but isn't user friendly. We want to make one that is > user-friendly so that others can try the same thing (would make a > great art/science lab!), and I want to integrate it with Chimera. I'm > attaching his program to this email so you can see what its doing. > Again, thanks a lot for the help! > Dan > > > On Thu, Jul 12, 2012 at 12:52 AM, Tom Goddardwrote: > > Hi Dan, > > The method I described could easily dump out the distances along > the 4 box edges where the cuts cross. From those numbers I could > mark a beam. But how to make an angled cut depends on what kind > of saw you are using. Using a wood radial arm type miter saw I > think you can usually adjust the blade rotation about the vertical > axis, but not about any other axis. Maybe some can be tilted > about the horizontal front back axis too. In any case your saw or > cutting machine needs to have two degrees of freedom to make the > cut any plane through a box shaped beam. There are lots of > differing conventions for Euler angles so if your saw used Euler > angles it would be necessary to know the exact convention and > reference frame. There are 3 Euler angles and this problem only > involves two angles. In summary, any quantitative description of > the cuts could be output relatively easily, the hard part is > providing a precise specification that defines those output > values. I think it looks cool and am happy to take a crack at the > Python code if I know exactly what is needed. > > Tom > > > >> A method of computing a surface model like you describe would be >> great Tom. Thanks. During the planning stages for the sculptures >> I just played with bond thickness until I had something that >> looked close to what we were making (see attached figure, c and >> d). A true boxed backbone would be better. Also, a script and >> explanation like yours would be useful for teaching, as another >> little example of useful intersections between computer science, >> math, biochemistry and art. >> >> But the other aim I have is to use Chimera to obtain the >> distances from point to point along the four edges of a real beam >> of some specified thickness (and with a specified distance from >> alpha carbon to alpha carbon). Marking and connecting these >> points would result in a series of planes for making miter-cuts. >> If the material is symmetrical, a linear beam can be transformed >> into a 3D backbone by cutting at these planes and then inverting >> every other segment (see attached figure, a and b). That's where >> the Euler angles come in. >> Dan >> >> On Wed, Jul 11, 2012 at 7:25 PM, Tom Goddard wrote: >> >> Hi Dan, >> >> If your aim is to draw the box beam protein backbone one >> way to go about it is as follows. Make the 4 paths that >> follow the box corners and traverse one end of the protein to >> the other. How to do this. Start at one end and place a >> square (the box beam cross-section) with center at the first >> backbone atom and with its plane perpendicular to the line >> between atom 1 and atom 2. Then draw lines starting from >> each corner of the square parallel to the line between atoms >> 1 and 2. To decide where these lines have to turn at atom 2 >> create a plane that passes through atom 2 and is >> perpendicular to the plane defined by atoms 1, 2, and 3 and >> bisects the angle formed by segments 1/2 and 2/3. The lines >> from 1 to 2 bend when they hit that plane and new lines head >> off parallel to the line between atoms 2 and 3. Now repeat >> the process to find where those lines bend on the bisecting >> plane through atom 3. Once you have the 4 lines with all >> their bend points you can draw a quadrilateral for each box >> face using the 4 appropriate line bend points. In this >> prescription the rotational orientation of the square placed >> at the start is arbitrary. Different rotations will give >> different appearances. The calculation would be very fast >> and the whole box path could be updated in real time as you >> rotated the end and that causes rotation of all the other box >> beam segments. >> >> The analytic geometry to do this calculation and make the >> surface model in Chimera is not too hard and I could give you >> a bit of Python code to do it and display in Chimera if you like. >> >> Tom >> >> >> >>> Dan, >>> Tom Goddard is our "Euler angle expert", so I'm forwarding >>> this along! >>> >>> --Eric >>> >>> Begin forwarded message: >>> >>>> *From: *Daniel Gurnon >>>> *Date: *July 11, 2012 2:25:36 PM PDT >>>> *To: *Eric Pettersen >>>> *Subject: **Re: [Chimera-users] Texans: get to work!* >>>> >>>>> >>>> I guess I'm baffled by the question. :-) The >>>> difference in coordinates for two atoms is a >>>> translation vector. What does the "rotation matrix for >>>> two atoms" mean exactly? >>>> >>>> --Eric >>>> >>>> >>>> I didn't explain that very well at all. Bear with me here, >>>> because I haven't had a math class in almost 20 years.... >>>> >>>> Say a protein is displayed as a backbone trace, from alpha >>>> carbon to alpha carbon. So, aC1 and aC2 make a line. I want >>>> to know how to get from aC2 to aC3 by way of Euler angles, >>>> and then how to get to aC4 relative to the line between >>>> aC2-C3, and on and on down the line. In other words, these >>>> angles would allow me to take all of the coordinates of the >>>> 3D structure and translate them into a straight line...or >>>> more importantly, to take a straight line of atoms and >>>> transform it into a 3D structure. >>>> >>>> The artist I worked with on the protein sculptures, Julian >>>> Voss Andreae, basically used this approach to turn the >>>> coordinates from a pdb file into cutting instructions for >>>> the steel. When we made the sculptures, I used chimera to >>>> render proteins similar to how they would appear as final, >>>> welded sculptures. When we decided on our "subjects", I >>>> gave Julian the coordinates and he used his program to >>>> create the instructions. He wrote a program of his own to >>>> do this, but it requires programming knowledge to use it. >>>> My goal is to make a user-friendly version for students, >>>> and I want to integrate it with chimera to take advantage >>>> of all of the built-in display options. >>> >>

1 0

Re: [Chimera-users] Chimera Surface Calculation
by Tom Goddard 18 Jul '12

18 Jul '12

Hi Robert, Unfortunately the MSMS molecular surface calculation code has bugs and so it fails to compute surfaces for most large (>10,000 atom) PDB models. The surface calculation has essentially no chance of working with a model of 110,000 atoms such as your half-virus. That said I used the 64-bit Mac Chimera and split the model by chains and it surfaced fine -- see attached image. The Windows Chimera versions have the most surface calculation failures especially 64-bit Windows Chimera, and Mac and Linux are substantially better. So I made the image bmv.jpg with "split #0; surf; rainbow model". After the split, it is odd that many of the subunits have no atoms shown. I used Actions / Atoms / Show to show them. If you don't require a solvent excluded surface (rolling a ball over the atoms to get the surface), you can use a Gaussian surface. The second image bmv5.jpg was made without splitting the model using a 5 Angstrom density map. molmap #0 5 model #1 volume #1 step 1 color lightblue :.A color lightyellow :.B color pink :.C color red :.D-K scolor #1 zone #0 range 10 Tom > Hi Tom, > I am a post doc at Indiana University in the Biochemistry department, and I was at the chimera tutorial you gave to our department through David Morgan. I wasn't sure who to write with this question, so I thought I would start with you but if this is more appropriate for someone else, just let me know. > > Forever ago I used Viper to create a 60 subunit (or 1/2) capsid for BMV, and made several models for publications. That .pdb file that I made no longer works within Chimera, and I have literally tried everything to get it to work. Additionally, it seems Viper no longer lets you make those .pdb files anymore. I have tried changing the atomic radii probe radius, the vertex density, set the disjoint surfaces to false, and every combination of those things. Additionally, when I use the split command, it either only shows a weird surface or no surface at all, and almost completely obliterates the original structure. If you know another way to do this, I would really appreciate any advice here as I have spent hours reading through forums. I attached the .pdb to this email. Again I really appreciate your help. > > Thanks in advance, > Robert > >

4 3

Stick and Ribbon Connection
by Ardian Soca Wibowo 17 Jul '12

17 Jul '12

Hello, I have modeled a structure where a portion is model as sticks while an adjacent portion is a ribbon. The space between the two representation is disconnected. In the overall view of the figure, this broken space is an eyesore, thus I would like to know a way/command that will connect the disconnected portion between the stick and ribbon representations. Thanks in advanced for the help. Ardian -- Ardian Soca Wibowo, Ph.D. Postdoctoral Associate Dann Research Group Department of Chemistry Indiana University Simon Hall Rm. 309 812-856-3216 awibowo(a)indiana.edu

2 3

Trouble with display options
by vamsee 17 Jul '12

17 Jul '12

Hi, I am Vamseedhar Rayaprolu (Vamsee). I work with viruses and I am trying to generate a movie using only a script and NO GUI. I use a viral protein from the VIPERdb and hence it automatically generates a multimer (capsid) for me. The underlying question is 2-fold. The model generated from a vdb file is a pseudo-model and doesn't carry any co-ordinates for each of the subunits. Therefore the whole model is numbered #modelnumber (#1 in this case). The capsid has 60 subunits and when I mouse-over onto each of the subunits, it shows me the model number and the sub-model number but when I try to access the sub models through the command line, it selects #1 as a whole and not the sub-model. I need to be able to select each sub-model through the command line. Any ideas on this? Next, I need to be able to show each sub-model in a ribbon form. Trying to show the whole model (#1) in the ribbon form using a command doesn't work. It works when done from the GUI though. I know if I can split the above multimer into sub-models I should be able to use the ribbon command and get what I need. But the split command doesn't work on the model as there are not atomic co-ordinates (pseudo-model). Any suggestions on this? Thank you -Vamsee

3 2

Re: [Chimera-users] Programming within Chimera
by Mario Dejung 12 Jul '12

12 Jul '12

Thanks Conrad, I really must have been blind, didn't found the IDLE window. I also leave the "open file window" open, makes it much easier, but to figure out which variables are set and how a list of open model looks like etc, it makes it much easier to use idle :-) Thanks a lot!

1 0