- Chimera-users - RBVI Mailing Lists

Modelling of missing regions ussing Chimera
by Gleb Novicov 08 Aug '12

08 Aug '12

Dear Chimera's users! I need to model some missing segments ( In particular case I need to build missing N and C termi ) of my protein ussing Modeller's options. Could you tell me about possible solution of that issue ? On my win7 I have installed Chimera as well as Modeller v 9.10 suite. I've defined Modeller pathways in the Chimera's Model pool options but when I've selected option Prune seection to define region of interest I didnt obtain anythinf from both of Chimera or Modeller. On other hand the option Structure -> Modeller tools also not available for me. Does it means that I've installed modeller incorrectly ? Also I've used runmod.dat script with defined variables from which I obtained the below C:\Users\own\Desktop\worktemp>runmod.bat usage: mod9.10 script [...] Doest this means that all work fine ? By the way after executing of that script I could not launch modeller by means of mod9.10.exe from modeller folder. The error from modeller was C:\Program Files\Modeller\bin>mod9.10.exe FATAL ERROR: MODINSTALL9v10 environment variable not set: incomplete MODELLER in stallation Could you explain me whats I've done wrong and how I could fix this problem? Thanks for help Gleb

4 5

Re: [Chimera-users] Chimera-users Digest, Vol 112, Issue 2
by vamsee 07 Aug '12

07 Aug '12

Hello, I am trying to script distance measurements (distance monitor) between the Calpha of a residue and a few Hydrogens. I have pretty much everything working except that I am not able to figure out how to change the attributes (color, line style etc..) of the distances (pseudo-bonds). I know it can be changed using the GUI but I would rather script it. Any suggestions? Thank you Vamsee On Thu, Aug 2, 2012 at 1:00 PM, <chimera-users-request(a)cgl.ucsf.edu> wrote: > Send Chimera-users mailing list submissions to > chimera-users(a)cgl.ucsf.edu > > To subscribe or unsubscribe via the World Wide Web, visit > http://plato.cgl.ucsf.edu/mailman/listinfo/chimera-users > or, via email, send a message with subject or body 'help' to > chimera-users-request(a)cgl.ucsf.edu > > You can reach the person managing the list at > chimera-users-owner(a)cgl.ucsf.edu > > When replying, please edit your Subject line so it is more specific > than "Re: Contents of Chimera-users digest..." > > > Today's Topics: > > 1. combining mrc maps (Daniel Murin) > 2. Re: combining mrc maps (Elaine Meng) > 3. Re: combining mrc maps (Tom Goddard) > 4. double bonds visualization ? (Marek Maly) > > > ---------------------------------------------------------------------- > > Message: 1 > Date: Wed, 1 Aug 2012 18:58:53 -0700 > From: Daniel Murin <cmurin(a)scripps.edu> > To: "chimera-users(a)cgl.ucsf.edu" <chimera-users(a)cgl.ucsf.edu> > Subject: [Chimera-users] combining mrc maps > Message-ID: > < > 83025BE3F3B8D644AA9F8CAA21F2640801A3D700C402(a)EXCH-CCR01.lj.ad.scripps.edu> > > Content-Type: text/plain; charset="us-ascii" > > Hi, > > I was wondering if it is possible to combine two mrc volumes into a single > volume and save that as a new mrc file? I haven't really been able to find > anything and I suspect that this may not be possible with Chimera. > > Thank you for your help, > > Daniel > > > > Charles Daniel Murin > Graduate Student - Ward/Ollmann-Saphire Labs > Department of Molecular Biology > Kellogg School of Science and Technology > The Scripps Research Institute > 10550 North Torrey Pines Road, CB 227 > La Jolla, CA 92037 > > Work: 858.784.9053 > Fax: 858.784.8218 > email: cmurin(a)scripps.edu > > > > ------------------------------ > > Message: 2 > Date: Thu, 2 Aug 2012 10:06:36 -0700 > From: Elaine Meng <meng(a)cgl.ucsf.edu> > To: Daniel Murin <cmurin(a)scripps.edu> > Cc: "chimera-users(a)cgl.ucsf.edu" <chimera-users(a)cgl.ucsf.edu> > Subject: Re: [Chimera-users] combining mrc maps > Message-ID: <20D05B2F-142C-4433-B4A3-A8BAB0242919(a)cgl.ucsf.edu> > Content-Type: text/plain; charset=us-ascii > > Hi Daniel, > You can add or subtract maps to make a new map using the "vop" command: > > <http://www.cgl.ucsf.edu/chimera/docs/UsersGuide/midas/vop.html> > > That command has various other filtering and scaling options that may also > be of interest. You can save the new map to a file using the Volume Viewer > dialog (its File menu) or the "volume" command. > > I hope this helps, > Elaine > ---------- > Elaine C. Meng, Ph.D. > UCSF Computer Graphics Lab (Chimera team) and Babbitt Lab > Department of Pharmaceutical Chemistry > University of California, San Francisco > > On Aug 1, 2012, at 6:58 PM, Daniel Murin wrote: > > > Hi, > > I was wondering if it is possible to combine two mrc volumes into a > single volume and save that as a new mrc file? I haven't really been able > to find anything and I suspect that this may not be possible with Chimera. > > Thank you for your help, > > Daniel > > > > > ------------------------------ > > Message: 3 > Date: Thu, 02 Aug 2012 10:07:18 -0700 > From: Tom Goddard <goddard(a)sonic.net> > To: Daniel Murin <cmurin(a)scripps.edu> > Cc: "chimera-users(a)cgl.ucsf.edu" <chimera-users(a)cgl.ucsf.edu> > Subject: Re: [Chimera-users] combining mrc maps > Message-ID: <501AB3C6.2050900(a)sonic.net> > Content-Type: text/plain; charset=ISO-8859-1; format=flowed > > Hi Daniel, > > Yes, just add the two map with the volume operation command > > vop add #1,2 > > This will extend the grid of map #1 to cover map #2 then interpolate map > #2 on that grid and add it. You may also want to scale the values of > one map so that the two maps have comparable density ranges using the > "scaleFactors" option. > > http://www.cgl.ucsf.edu/chimera/current/docs/UsersGuide/midas/vop.html#add > > Tom > > > > Hi, > > > > I was wondering if it is possible to combine two mrc volumes into a > single volume and save that as a new mrc file? I haven't really been able > to find anything and I suspect that this may not be possible with Chimera. > > > > Thank you for your help, > > > > Daniel > > > > > > > > Charles Daniel Murin > > Graduate Student - Ward/Ollmann-Saphire Labs > > Department of Molecular Biology > > Kellogg School of Science and Technology > > The Scripps Research Institute > > 10550 North Torrey Pines Road, CB 227 > > La Jolla, CA 92037 > > > > > > ------------------------------ > > Message: 4 > Date: Thu, 02 Aug 2012 20:00:51 +0200 > From: "Marek Maly" <marek.maly(a)ujep.cz> > To: chimera-users(a)cgl.ucsf.edu > Subject: [Chimera-users] double bonds visualization ? > Message-ID: <op.wifdnpi4lc8gdf(a)pocitadlon.ujep.cz> > Content-Type: text/plain; charset=iso-8859-2; format=flowed; delsp=yes > > Hello, > > I am just curious if it is possible to visualize double bonds > as double bonds now similarly like in case of rings one > can visualize them nicely (aromatic ring/disc). > > Thanks for the info in advance, > > Best wishes, > > Marek > > > -- > Tato zpr?va byla vytvo?ena p?evratn?m po?tovn?m klientem Opery: > http://www.opera.com/mail/ > > > ------------------------------ > > _______________________________________________ > Chimera-users mailing list > Chimera-users(a)cgl.ucsf.edu > http://plato.cgl.ucsf.edu/mailman/listinfo/chimera-users > > > End of Chimera-users Digest, Vol 112, Issue 2 > ********************************************* >

2 2

(no subject)
by Merced Malabanan 06 Aug '12

06 Aug '12

Hi, I'm trying to get used to the new Rapid Access interface of chimera. But how do you remove the list (or items on the list) on the right side of the interface? Thanks.

2 1

SASA vs. MSA
by Nikolay Igorovich Rodionov 05 Aug '12

05 Aug '12

Hi all, I was wondering if you could help me conceptualize what is going on in this situation. I ran both solvent accessible surface area and solvent excluded (molecular) surface area calculations. When I compared the output for both of these calculations I found that, overall, atoms that contribute to the SASA are buried 1-3 angstroms deeper in the protein than those that contribute to the MSA. I don't really understand how this could be unless the deeper buried SASA atoms have a much larger van der waals radii than MSA atoms (I get that some atoms contribute to both). Thanks!

2 6

trajectory rmsd
by George Tzotzos 03 Aug '12

03 Aug '12

I'm writing to find out if it is possible to determine the rmsd of specific residues, say 20-120 (backbone atoms only) from a trajectory against the corresponding residues of an X-ray structures. I used the Movie tool to load the trajectory having loaded prior to it the reference structure. I couldn't find a way to compute what I described above. Your help as always is much appreciated Best regards George

2 1

Inifinite lattice minimisation
by Kyle Morris 03 Aug '12

03 Aug '12

Dear all, I am trying to do minimisations on a crystal system. I wonder if when chimera knows the unit cell will it minimise as an infinite lattice or do the copies need to be explicitly created before minimisation proceeds? Really appreciate any help/insight. Best wishes, Kyle

2 2

combining mrc maps
by Daniel Murin 02 Aug '12

02 Aug '12

Hi, I was wondering if it is possible to combine two mrc volumes into a single volume and save that as a new mrc file? I haven't really been able to find anything and I suspect that this may not be possible with Chimera. Thank you for your help, Daniel Charles Daniel Murin Graduate Student - Ward/Ollmann-Saphire Labs Department of Molecular Biology Kellogg School of Science and Technology The Scripps Research Institute 10550 North Torrey Pines Road, CB 227 La Jolla, CA 92037 Work: 858.784.9053 Fax: 858.784.8218 email: cmurin(a)scripps.edu

3 3

double bonds visualization ?
by Marek Maly 02 Aug '12

02 Aug '12

Hello, I am just curious if it is possible to visualize double bonds as double bonds now similarly like in case of rings one can visualize them nicely (aromatic ring/disc). Thanks for the info in advance, Best wishes, Marek -- Tato zpráva byla vytvořena převratným poštovním klientem Opery: http://www.opera.com/mail/

2 2

Re: [Chimera-users] FW: FW: problem in visualising metal- atoms in simulated
by Mahendra B Thapa 31 Jul '12

31 Jul '12

Dear Dr. Elaine, May I send my pdb file? I could not fix the problems; I tried my best as far as I can , with possible alternatives. Thanks, Mahendra Thapa University of Cincinnati On Mon, Jul 30, 2012 at 12:58 PM, Thapa, Mahendra (thapamb) < thapamb(a)mail.uc.edu> wrote: > > > > ________________________________________ > From: Elaine Meng > Sent: Monday, July 30, 2012 10:58:32 AM (UTC-06:00) Central America > To: Thapa, Mahendra (thapamb) > Cc: chimera-users(a)cgl.ucsf.edu > Subject: Re: [Chimera-users] FW: problem in visualising metal- atoms in > simulated > > The atom names of the ions should not be lined up with the other names, > and the last field should be CA not C. So there are at least two problems > with these lines. Please see the format description in the link in my > previous message. > > Some additional problems are that the ion lines should probably be HETATM > not ATOM, and the names CA not CO. So I would fix those things too. > Best, > Elaine > > On Jul 30, 2012, at 9:46 AM, Mahendra B Thapa wrote: > > > Dear Dr. Elaine, > > > > The last few lines of the file are as follows: > > ATOM 1212 OXT GLN 76 17.333 31.515 17.211 1.00 0.00 > O > > TER > > ATOM 1213 CO CAL 77 35.029 27.971 38.126 1.00 0.00 > C > > TER > > ATOM 1214 CO CAL 78 37.868 20.307 30.270 1.00 0.00 > C > > TER > > > > I also tried with Ca instead of C in the last column , but no > improvement. > > > > Thank you for help, > > Mahendra Thapa > > University of Cincinnati > > > > > > On Mon, Jul 30, 2012 at 12:34 PM, Thapa, Mahendra (thapamb) < > thapamb(a)mail.uc.edu> wrote: > > > > > > > > ________________________________________ > > From: Elaine Meng > > Sent: Monday, July 30, 2012 10:34:51 AM (UTC-06:00) Central America > > To: Thapa, Mahendra (thapamb) > > Cc: chimera-users(a)cgl.ucsf.edu > > Subject: Re: [Chimera-users] problem in visualising metal- atoms in > simulated > > > > Hi Mahendra, > > Probably the format is slightly wrong for the lines with the calcium ion > coordinates. For example, the name CA for the calcium ion should *not* line > up with the name CA in the protein alpha-carbon lines. > > > > In the ATOM and HETATM lines of PDB files, > > < > http://www.cgl.ucsf.edu/chimera/docs/UsersGuide/tutorials/pdbintro.html#coo… > > > > > > ...the ion name CA should be in columns 13-14, whereas the alpha-carbon > name CA should be in columns 14-15. > > > > Misalignment of ion names is a common problem with the output of many > programs. > > < > http://www.cgl.ucsf.edu/chimera/docs/UsersGuide/tutorials/pdbintro.html#mis… > > > > > > Best, > > Elaine > > ---------- > > Elaine C. Meng, Ph.D. > > UCSF Computer Graphics Lab (Chimera team) and Babbitt Lab > > Department of Pharmaceutical Chemistry > > University of California, San Francisco > > > > On Jul 30, 2012, at 9:21 AM, Mahendra B Thapa wrote: > > > > > Dear Chimera Users, > > > I converted amber-12 generated rst-file in netCDF format [ > test_equil.rst ] to the pdb format [ test_equil_rst.pdb] by using the > cpptraj command of amber 12. When I loaded it in chimera, the protein > structure looks fine but two calcium atoms that the protein binds could > not be visualised, although the pdb file-format looks good. > > > Let me help in this respect. > > > > > > > > > > _______________________________________________ > > Chimera-users mailing list > > Chimera-users(a)cgl.ucsf.edu > > http://plato.cgl.ucsf.edu/mailman/listinfo/chimera-users > > > >

2 1

Unable to visualize density maps
by Anindito Sen 30 Jul '12

30 Jul '12

Dear All, With the latest Chimera version in Daily Build for Mac , I am unable to visualize any density map in the "surface" and the "mesh" mode. On playing around trying to visualize the density maps I get something like the following attached figure. However I can see the maps at the "solid" mode. I am using Snow Leopard 10.6.8. Best Andy Versions Not Working: Mac OS X chimera-alpha-mac.dmg Size: 105982078 bytes MD5: ba098e1169a7fb37f9b80bbac27cae26 Jul 28, 2012 Mac OS X 64-bit chimera-alpha-mac64.dmg Size: 93344817 bytes MD5: 22700ce0b2b0272d3efe060832933ee5 Jul 28, 2012 Dr. Anindito Sen (Ph.D) >Department of Cell Biology & Anatomy >Graduate School of Medicine >University of Tokyo >Tel & fax: +81-3-5841-3339

2 1

ff dat file
by Nikolay Igorovich Rodionov 30 Jul '12

30 Jul '12

Hi, since I am able to implement various force fields, does that mean that I have the .dat files of those ff buried somewhere in my chimera directory? I want to add my custom ff parameters to PDB2PQR so I need to locate the .dat files of force fields like Amber12 and Amber99SB. Thank you, Nikolay Rodionov

3 2

Re: [Chimera-users] FW: problem in visualising metal- atoms in simulated
by Mahendra B Thapa 30 Jul '12

30 Jul '12

Dear Dr. Elaine, The last few lines of the file are as follows: ATOM 1212 OXT GLN 76 17.333 31.515 17.211 1.00 0.00 O TER ATOM 1213 CO CAL 77 35.029 27.971 38.126 1.00 0.00 C TER ATOM 1214 CO CAL 78 37.868 20.307 30.270 1.00 0.00 C TER I also tried with Ca instead of C in the last column , but no improvement. Thank you for help, Mahendra Thapa University of Cincinnati On Mon, Jul 30, 2012 at 12:34 PM, Thapa, Mahendra (thapamb) < thapamb(a)mail.uc.edu> wrote: > > > > ________________________________________ > From: Elaine Meng > Sent: Monday, July 30, 2012 10:34:51 AM (UTC-06:00) Central America > To: Thapa, Mahendra (thapamb) > Cc: chimera-users(a)cgl.ucsf.edu > Subject: Re: [Chimera-users] problem in visualising metal- atoms in > simulated > > Hi Mahendra, > Probably the format is slightly wrong for the lines with the calcium ion > coordinates. For example, the name CA for the calcium ion should *not* line > up with the name CA in the protein alpha-carbon lines. > > In the ATOM and HETATM lines of PDB files, > < > http://www.cgl.ucsf.edu/chimera/docs/UsersGuide/tutorials/pdbintro.html#coo… > > > > ...the ion name CA should be in columns 13-14, whereas the alpha-carbon > name CA should be in columns 14-15. > > Misalignment of ion names is a common problem with the output of many > programs. > < > http://www.cgl.ucsf.edu/chimera/docs/UsersGuide/tutorials/pdbintro.html#mis… > > > > Best, > Elaine > ---------- > Elaine C. Meng, Ph.D. > UCSF Computer Graphics Lab (Chimera team) and Babbitt Lab > Department of Pharmaceutical Chemistry > University of California, San Francisco > > On Jul 30, 2012, at 9:21 AM, Mahendra B Thapa wrote: > > > Dear Chimera Users, > > I converted amber-12 generated rst-file in netCDF format [ > test_equil.rst ] to the pdb format [ test_equil_rst.pdb] by using the > cpptraj command of amber 12. When I loaded it in chimera, the protein > structure looks fine but two calcium atoms that the protein binds could > not be visualised, although the pdb file-format looks good. > > Let me help in this respect. > > > >

2 1

problem in visualising metal- atoms in simulated
by Mahendra B Thapa 30 Jul '12

30 Jul '12

Dear Chimera Users, I converted amber-12 generated rst-file in *netCDF format* [ test_equil.rst ] to the pdb format [ test_equil_rst.pdb] by using the cpptraj command of amber 12. When I loaded it in chimera, the protein structure looks fine but two calcium atoms that the protein binds could not be visualised, although the pdb file-format looks good. Let me help in this respect. Thanks, Mahendra Thapa University of Cincinnati

2 1

Coulombic Potential Dielectric
by Nikolay Igorovich Rodionov 26 Jul '12

26 Jul '12

Hi, I just have a question about the default dielectric coefficient in the Coulombic surface coloring function. Does the coefficient of 4 correspond to the dielectric of the solvent or the solute (the biomolecule)? I think the latter makes more sense but I just want to make sure. Thanks! Nikolay Rodionov

2 2

Pot.dx to cartesian
by Nikolay Igorovich Rodionov 26 Jul '12

26 Jul '12

Hi all, I was wondering if anyone knows of a program that can take the gridpoint potential matrix from the APBS output pot.dx file and convert it into Cartesian coordinates. Something like: X Y Z Potential 545 5 54 +2.5484 Thanks! Nikolay Rodionov

1 0

how do I open RMF files in chimera on Mac?
by Khuri, Natalia 26 Jul '12

26 Jul '12

Natalia Khuri PhD Student, Graduate Group in Biophysics Laboratory of Andrej Sali UCSF MC 2552 Byers Hall Room 503B 1700 4th Street San Francisco, CA 94158-2330, USA

2 1

Doubt regarding cryeom map density threshold setting
by rakesh ramachandram 24 Jul '12

24 Jul '12

Hello, My name is Rakesh. I would like to know how to set the density threshold according to the molecular mass of the protein in the cryoem map. I would also like to know how to calculate the molecular mass of a particular segment after segmentation in cryoem map. Regards Rakesh Ramachandran PhD Student Molecular Biophysics Unit, Indian Institute of Science, Bangalore - 560012 India

2 5

thioester linkage between two protein
by Hamze Rahimi 24 Jul '12

24 Jul '12

Dear Expert I want defiend a thioester linkage between the C-terminal carboxyl group of G and the sulfhydral group of cysteine in the middle of other protein. Please let me know if there is such possibility in Chimera Best wish -- Hamzeh Rahimi PhD student in Medical Biotechnology INT-KIT,Karlsruhe

2 1

Radial color solid style map display
by Tom Goddard 23 Jul '12

23 Jul '12

Hi David, Radially coloring using solid style map display doesn't work. Solid style display of a single plane with volume viewer uses a gray-level coloring of the plane. The Surface Color tool and other coloring tools in Chimera replace the coloring of a surface and aren't able to modulate the existing (gray-level) coloring. But there are often tricky ways to get what you want. I've attached a picture of a radial color of a plane of an HIV tomogram. I did it by opening the map twice. With the first copy I display the solid style plane. With the second copy I display one plane in surface style with a low contour level. Then I placed a marker (volume tracer) at the center of a virus on that surface and used surface color to color that surface radially (scolor command). Then I made that surface transparent (command "transp 90 #1" in Chimera daily build). It didn't look good because the two planes were coincident which created artifacts, so I froze the first map (Model Panel, deactivate) and moved the second one a tiny bit in front. Also I made the background color gray -- black or white give somewhat different appearance. You could also layer a transparent radial colored layer on top in PhotoShop or Gimp I bet. Tom > Hi Tom, > I'm writing as I would like to color by radius an EM map but when it is displayed as a single plane of width=1 pixel. > Is this possible? > Thanks a lot > David > > David Veesler > Research Associate > The structural Virology lab - Johnson's lab > Department of Molecular Biology > The Scripps Research Institute > > >

1 0

CHIMERA clarification / mis-alignment?
by Anand K S Rao 20 Jul '12

20 Jul '12

Greetings to all CHIMERA Forum members / users / bug-fixers I am PhD student working on trying to identify F-box domains in plant proteomes, primarily via sequence based approaches like HMM profile based discovery. In order to build the profile HMM, I am building my seed alignment with the use of a structural alignment of solved crystal structures of human F-box proteins. Specifically, I seek some help from you or any of your lab members regarding what might possibly be a bug in your CHIMERA, and also help with protocol / parameter choice for both Matchmaker and Match->Align work I am doing. The PDBs trimmed to just the domain regions of my interest are attached as zipped folder #1. When I use default parameters for Matchmaker followed by default parameters for Match->Align, I obtain a multiple sequence alignment that appears well conserved except at the N and C terminals (based on RMSD track in the output EPS file) - However, for 2E31-A, the LW di-peptide (in the 2nd row of the alignment) is matched with the rest of the multipel sequence alignment. Please see attachment #2 - this mismatch in the MSA, is actually a structural match as seen via CHIMERA and PyMOL. So my *question #1* is how can I be sure that other residues have been accurately aligned in 3D and then accurately aligned in the 2D MSA? If this even an artifact, is it caused more by some error in my choice of methods / parameters or is this indeed a mis-alignment that should be all alignment LW at those two positions? (which is how it looked even in PyMol after structural superposition) And my *question #2* is what are the most appropriate parameters to be used for the purposes for my Match -> Align work? Should I use iteration for Matchmaker or not, if so how many or until convergence, if yes or otherwise, what should the residue RMSD not exceed? Should I retain it as the default 5A or do down to a conservative 1A instead? Thanks for any help in this regard. Sincerely, Anand -- Anand K.S. Rao PhD candidate Plant Biology Graduate Group President Indian Graduate Student Association @ UCDavis University of California at Davis Davis, CA - 95616 USA -------------------------------------------- CTTATTGTTGAACTTOAATGGTGCTAATGATCCTCGTOTCTCCTGAACGT (translate THAT!) -- Anand K.S. Rao PhD candidate Plant Biology Graduate Group President Indian Graduate Student Association @ UCDavis University of California at Davis Davis, CA - 95616 USA -------------------------------------------- CTTATTGTTGAACTTOAATGGTGCTAATGATCCTCGTOTCTCCTGAACGT (translate THAT!) -- Anand K.S. Rao PhD candidate Plant Biology Graduate Group President Indian Graduate Student Association @ UCDavis University of California at Davis Davis, CA - 95616 USA -------------------------------------------- CTTATTGTTGAACTTOAATGGTGCTAATGATCCTCGTOTCTCCTGAACGT (translate THAT!)

2 1

Box-beam protein sculptures
by Tom Goddard 18 Jul '12

18 Jul '12

Hi Dan, I added the "shape boxpath" command to Chimera to display box-beam protein backbones and output cut distances for making your physical models. http://collegenews.org/faculty-focus/2011/welding-art-and-science.html I've attached an example picture and command script that made that picture. More details, for example, how to get the cut distances is given in the Chimera feature/bug database: http://plato.cgl.ucsf.edu/trac/chimera/ticket/11191#comment:1 I have not tested the output cut distances so you should do some sanity checks with simple test cases before you trust those numbers. If you are curious about the code it is here http://plato.cgl.ucsf.edu/trac/chimera/browser/trunk/libs/Shape/boxpath.py The new command will be in tonight's Chimera daily builds. Here's a weird connection. These sculptural box beams may help display large molecules on cell phones! Cell phones have slow 3-d graphics and this square cross-section depiction would place minimal computational demands on the phone. Typical depictions with spheres and cylinders and smooth ribbons require a lot more computational power. Tom -------- Original Message -------- Subject: Re: Fwd: [Chimera-users] Texans: get to work! From: Daniel Gurnon To: Tom Goddard Date: 7/17/12 3:26 PM > Hi Tom, > Sorry for the delay- I was just about to email you when I discovered > your message. Missed it the first time somehow. Thanks for offering to > help. > > The key to the saw problem is doing it old-school: Julian > Voss-Andreae (the artist who came up with the idea of turning protein > backbones into miter-cut sculptures) showed me how to use a Japanese > pull-saw to make the cuts by hand. Besides being easier than setting > up a miter saw, the small kerf minimizes material loss. The distances > along the edges allow us to trace out the plane, and then you just > carefully cut along the line. > > When we did this in steel we used grinders to cut out each piece from > a box beam. It was a little more difficult than it was with wood, > because to make the welds look right we had to account for the > thickness of the material. > > And about the Euler angles- right, there would only be two in this > case. The third is what allows us to translate the 3D structure back > into a linear piece of material. As long as the material is > symmetrical, you can make the miter cuts and just flip every other piece. > > So as I mentioned in my earlier message, Julian's C++ program does > this but isn't user friendly. We want to make one that is > user-friendly so that others can try the same thing (would make a > great art/science lab!), and I want to integrate it with Chimera. I'm > attaching his program to this email so you can see what its doing. > Again, thanks a lot for the help! > Dan > > > On Thu, Jul 12, 2012 at 12:52 AM, Tom Goddardwrote: > > Hi Dan, > > The method I described could easily dump out the distances along > the 4 box edges where the cuts cross. From those numbers I could > mark a beam. But how to make an angled cut depends on what kind > of saw you are using. Using a wood radial arm type miter saw I > think you can usually adjust the blade rotation about the vertical > axis, but not about any other axis. Maybe some can be tilted > about the horizontal front back axis too. In any case your saw or > cutting machine needs to have two degrees of freedom to make the > cut any plane through a box shaped beam. There are lots of > differing conventions for Euler angles so if your saw used Euler > angles it would be necessary to know the exact convention and > reference frame. There are 3 Euler angles and this problem only > involves two angles. In summary, any quantitative description of > the cuts could be output relatively easily, the hard part is > providing a precise specification that defines those output > values. I think it looks cool and am happy to take a crack at the > Python code if I know exactly what is needed. > > Tom > > > >> A method of computing a surface model like you describe would be >> great Tom. Thanks. During the planning stages for the sculptures >> I just played with bond thickness until I had something that >> looked close to what we were making (see attached figure, c and >> d). A true boxed backbone would be better. Also, a script and >> explanation like yours would be useful for teaching, as another >> little example of useful intersections between computer science, >> math, biochemistry and art. >> >> But the other aim I have is to use Chimera to obtain the >> distances from point to point along the four edges of a real beam >> of some specified thickness (and with a specified distance from >> alpha carbon to alpha carbon). Marking and connecting these >> points would result in a series of planes for making miter-cuts. >> If the material is symmetrical, a linear beam can be transformed >> into a 3D backbone by cutting at these planes and then inverting >> every other segment (see attached figure, a and b). That's where >> the Euler angles come in. >> Dan >> >> On Wed, Jul 11, 2012 at 7:25 PM, Tom Goddard wrote: >> >> Hi Dan, >> >> If your aim is to draw the box beam protein backbone one >> way to go about it is as follows. Make the 4 paths that >> follow the box corners and traverse one end of the protein to >> the other. How to do this. Start at one end and place a >> square (the box beam cross-section) with center at the first >> backbone atom and with its plane perpendicular to the line >> between atom 1 and atom 2. Then draw lines starting from >> each corner of the square parallel to the line between atoms >> 1 and 2. To decide where these lines have to turn at atom 2 >> create a plane that passes through atom 2 and is >> perpendicular to the plane defined by atoms 1, 2, and 3 and >> bisects the angle formed by segments 1/2 and 2/3. The lines >> from 1 to 2 bend when they hit that plane and new lines head >> off parallel to the line between atoms 2 and 3. Now repeat >> the process to find where those lines bend on the bisecting >> plane through atom 3. Once you have the 4 lines with all >> their bend points you can draw a quadrilateral for each box >> face using the 4 appropriate line bend points. In this >> prescription the rotational orientation of the square placed >> at the start is arbitrary. Different rotations will give >> different appearances. The calculation would be very fast >> and the whole box path could be updated in real time as you >> rotated the end and that causes rotation of all the other box >> beam segments. >> >> The analytic geometry to do this calculation and make the >> surface model in Chimera is not too hard and I could give you >> a bit of Python code to do it and display in Chimera if you like. >> >> Tom >> >> >> >>> Dan, >>> Tom Goddard is our "Euler angle expert", so I'm forwarding >>> this along! >>> >>> --Eric >>> >>> Begin forwarded message: >>> >>>> *From: *Daniel Gurnon >>>> *Date: *July 11, 2012 2:25:36 PM PDT >>>> *To: *Eric Pettersen >>>> *Subject: **Re: [Chimera-users] Texans: get to work!* >>>> >>>>> >>>> I guess I'm baffled by the question. :-) The >>>> difference in coordinates for two atoms is a >>>> translation vector. What does the "rotation matrix for >>>> two atoms" mean exactly? >>>> >>>> --Eric >>>> >>>> >>>> I didn't explain that very well at all. Bear with me here, >>>> because I haven't had a math class in almost 20 years.... >>>> >>>> Say a protein is displayed as a backbone trace, from alpha >>>> carbon to alpha carbon. So, aC1 and aC2 make a line. I want >>>> to know how to get from aC2 to aC3 by way of Euler angles, >>>> and then how to get to aC4 relative to the line between >>>> aC2-C3, and on and on down the line. In other words, these >>>> angles would allow me to take all of the coordinates of the >>>> 3D structure and translate them into a straight line...or >>>> more importantly, to take a straight line of atoms and >>>> transform it into a 3D structure. >>>> >>>> The artist I worked with on the protein sculptures, Julian >>>> Voss Andreae, basically used this approach to turn the >>>> coordinates from a pdb file into cutting instructions for >>>> the steel. When we made the sculptures, I used chimera to >>>> render proteins similar to how they would appear as final, >>>> welded sculptures. When we decided on our "subjects", I >>>> gave Julian the coordinates and he used his program to >>>> create the instructions. He wrote a program of his own to >>>> do this, but it requires programming knowledge to use it. >>>> My goal is to make a user-friendly version for students, >>>> and I want to integrate it with chimera to take advantage >>>> of all of the built-in display options. >>> >>

1 0

Re: [Chimera-users] Chimera Surface Calculation
by Tom Goddard 18 Jul '12

18 Jul '12

Hi Robert, Unfortunately the MSMS molecular surface calculation code has bugs and so it fails to compute surfaces for most large (>10,000 atom) PDB models. The surface calculation has essentially no chance of working with a model of 110,000 atoms such as your half-virus. That said I used the 64-bit Mac Chimera and split the model by chains and it surfaced fine -- see attached image. The Windows Chimera versions have the most surface calculation failures especially 64-bit Windows Chimera, and Mac and Linux are substantially better. So I made the image bmv.jpg with "split #0; surf; rainbow model". After the split, it is odd that many of the subunits have no atoms shown. I used Actions / Atoms / Show to show them. If you don't require a solvent excluded surface (rolling a ball over the atoms to get the surface), you can use a Gaussian surface. The second image bmv5.jpg was made without splitting the model using a 5 Angstrom density map. molmap #0 5 model #1 volume #1 step 1 color lightblue :.A color lightyellow :.B color pink :.C color red :.D-K scolor #1 zone #0 range 10 Tom > Hi Tom, > I am a post doc at Indiana University in the Biochemistry department, and I was at the chimera tutorial you gave to our department through David Morgan. I wasn't sure who to write with this question, so I thought I would start with you but if this is more appropriate for someone else, just let me know. > > Forever ago I used Viper to create a 60 subunit (or 1/2) capsid for BMV, and made several models for publications. That .pdb file that I made no longer works within Chimera, and I have literally tried everything to get it to work. Additionally, it seems Viper no longer lets you make those .pdb files anymore. I have tried changing the atomic radii probe radius, the vertex density, set the disjoint surfaces to false, and every combination of those things. Additionally, when I use the split command, it either only shows a weird surface or no surface at all, and almost completely obliterates the original structure. If you know another way to do this, I would really appreciate any advice here as I have spent hours reading through forums. I attached the .pdb to this email. Again I really appreciate your help. > > Thanks in advance, > Robert > >

4 3

Stick and Ribbon Connection
by Ardian Soca Wibowo 17 Jul '12

17 Jul '12

Hello, I have modeled a structure where a portion is model as sticks while an adjacent portion is a ribbon. The space between the two representation is disconnected. In the overall view of the figure, this broken space is an eyesore, thus I would like to know a way/command that will connect the disconnected portion between the stick and ribbon representations. Thanks in advanced for the help. Ardian -- Ardian Soca Wibowo, Ph.D. Postdoctoral Associate Dann Research Group Department of Chemistry Indiana University Simon Hall Rm. 309 812-856-3216 awibowo(a)indiana.edu

2 3

Trouble with display options
by vamsee 17 Jul '12

17 Jul '12

Hi, I am Vamseedhar Rayaprolu (Vamsee). I work with viruses and I am trying to generate a movie using only a script and NO GUI. I use a viral protein from the VIPERdb and hence it automatically generates a multimer (capsid) for me. The underlying question is 2-fold. The model generated from a vdb file is a pseudo-model and doesn't carry any co-ordinates for each of the subunits. Therefore the whole model is numbered #modelnumber (#1 in this case). The capsid has 60 subunits and when I mouse-over onto each of the subunits, it shows me the model number and the sub-model number but when I try to access the sub models through the command line, it selects #1 as a whole and not the sub-model. I need to be able to select each sub-model through the command line. Any ideas on this? Next, I need to be able to show each sub-model in a ribbon form. Trying to show the whole model (#1) in the ribbon form using a command doesn't work. It works when done from the GUI though. I know if I can split the above multimer into sub-models I should be able to use the ribbon command and get what I need. But the split command doesn't work on the model as there are not atomic co-ordinates (pseudo-model). Any suggestions on this? Thank you -Vamsee

3 2

Re: [Chimera-users] Programming within Chimera
by Mario Dejung 12 Jul '12

12 Jul '12

Thanks Conrad, I really must have been blind, didn't found the IDLE window. I also leave the "open file window" open, makes it much easier, but to figure out which variables are set and how a list of open model looks like etc, it makes it much easier to use idle :-) Thanks a lot!

1 0

Texans: get to work!
by Eric Pettersen 11 Jul '12

11 Jul '12

Anybody made a Chimera image bigger than this one? Biology mural at James Madison University on the Behance Network (okay, okay, Chimera-assisted image — I think it counts!) --Eric

2 1

Question on volume viewer
by kirtana S 11 Jul '12

11 Jul '12

Dear Users, I did the steps as Action > Surface > show as solid and then measure volume . Can you tell me what are units of these values is. this in Angstroms^3 or nm^3 Kirti

2 1

Motion of an atom
by Raju Purohit 11 Jul '12

11 Jul '12

Hello friends, I need some help here. I created a basic model having just an atom and set its coordinates as (0,0,0). Now I want to make it move along a certain path defined mathematically (say, along x axis) and I need to see it move. So I used a * for* loop. But I couldn't see and motion and soon realised that the loop is very quick in executing and thus I could see the atom at its last coordinates. So I tried to add delay of 0.5 seconds for each loop by importing *time* module and useing *time.sleep*. But still I couldn't see any motion and the coordinates of the atom is set only at the end of the *for* loop. I could not see the intermediate path. I am sure you people must have tried this earlier and this problem has a solution but I just couldn't figure it out. Can you please help me out? Thank you in advance. -- Raju R.N. Third Year, B.Tech Mechanical Engineering National Institute of Technology Karnataka, Surathkal

4 5

Failure With DockPrep
by Dylan J. Bennett 10 Jul '12

10 Jul '12

Hi, I am attempting to run DockPrep on NQO2 which contains an FAD cofactor. Everything works until it attempts to add charges to FAD at which point it returns an error message. If I delete FAD it will return the same error message for the Zn ion. It seems to be unable to add charges for any non-amino acid molecules. I am running the latest stable build of Chimera. Interestingly, I know Chimera used to be able to calculate these charges with an old version I had but seems no longer able. Below is the reply log. Thank you. #0, chain A: nrh dehydrogenase [quinone] 2 #0, chain B: nrh dehydrogenase [quinone] 2 No incomplete side chains Terminii for WT_noH.pdb (#0) chain A determined from SEQRES records Terminii for WT_noH.pdb (#0) chain B determined from SEQRES records Chain-initial residues that are actual N terminii: ALA 1.A, ALA 1.B Chain-initial residues that are not actual N terminii: Chain-final residues that are actual C terminii: GLN 230.A, GLN 230.B Chain-final residues that are not actual C terminii: 482 hydrogen bonds Hydrogens added Charge model: AMBER ff99SB Assigning partial charges to residue ZN (net charge +2) with am1-bcc method Assigning partial charges to residue FAD (net charge +0) with am1-bcc method Running ANTECHAMBER command: C:/Program Files/Chimera 1.6.2/bin/amber11/bin\antechamber -ek qm_theory='AM1', -i c:\docume~1\dylan_~1\locals~1\temp\tmpy6za6o\ante.in.mol2 -fi mol2 -o c:\docume~1\dylan_~1\locals~1\temp\tmpy6za6o\ante.out.mol2 -fo mol2 -c bcc -nc 0 -j 5 -s 2 (FAD) (FAD) (FAD) Total number of electrons: 407; net charge: 0 (FAD) INFO: Number of electrons is odd: 407 (FAD) Please check the total charge (-nc flag) and spin multiplicity (-m flag) (FAD) (FAD) Running: "C:/Program Files/Chimera 1.6.2/bin/amber11/bin/sqm" -O -i sqm.in -o sqm.out (FAD) Error: cannot run ""C:/Program Files/Chimera 1.6.2/bin/amber11/bin/sqm" -O -i sqm.in -o sqm.out" of bcc() in charge.c properly, exit (FAD) Running: "C:/Program Files/Chimera 1.6.2/bin/amber11/bin/bondtype" -j part -i ANTECHAMBER_BOND_TYPE.AC0 -o ANTECHAMBER_BOND_TYPE.AC -f ac (FAD) (FAD) Running: "C:/Program Files/Chimera 1.6.2/bin/amber11/bin/atomtype" -i ANTECHAMBER_AC.AC0 -o ANTECHAMBER_AC.AC -p gaff Failure running ANTECHAMBER for residue FAD Check reply log for details -- -Dylan J. Bennett Dylan.John.Bennett(a)Gmail.com (914) 621-1149

2 1

Programming within Chimera
by Mario Dejung 10 Jul '12

10 Jul '12

Hi all, is there an easy way to test and develop programs within Chimera? I always write python scripts and open these in Chimera… Would be much easier to have something like idle or similar to develop scripts and test them. Or is there a better way I did not found? Looking forward to any suggestions. Kind regards Mario

3 5

(no subject)
by Khalil Raja Howard 10 Jul '12

10 Jul '12

Vv bb n8bv. Mvv vtbv t. B b7bn. B'v vb v v 7iv vt. B bv Sent from my Samsung Epic™ 4G Touch

1 0

chimera1.6.1 model panel
by MARY VARUGHESE 10 Jul '12

10 Jul '12

Hi, I have installed the chimera1.6.1 in ubuntu 64 bit. Installation successful. But in the model panel tool only the 'activate all' button is working. although added to the favourite list all other function buttons are not working. Do anyone know how to sort out this problem. Also do anyone know the correct usage of savesphgen command when used in the command line tool of chimera. Thanking you Mary Varughese

2 1

Android download
by Frank Irby 09 Jul '12

09 Jul '12

Hello I love using chimera I just upgraded my mac to 10.5.8. But I can't get past the python script for downloading chimera-1.6.2-mac.dmg I agree to the terms of use..... If you could email me a download link... That would be awsome.. Thanks Frank http://mandelscape.deviantart.com/gallery/ http://dreamscape.myartsonline.com/ Sent from Yahoo! Mail on Android

2 1

AMBER99SB
by Nikolay Igorovich Rodionov 09 Jul '12

09 Jul '12

Hi all, I just have a quick question. Is AMBER99SB a fixed charge or polarizable forcefield? Thank you, Nikolay Rodionov

2 6

Raytracing with clip planes
by Tom Goddard 09 Jul '12

09 Jul '12

Hi Ed, File / Save Image... with raytracing enabled correctly handles both the near clip plane and per-model clip planes in Chimera 1.6.1 and 1.6.2. Probably you are using an older Chimera release. I know at some point in the past the raytraced image saving did not handle clip planes. Tom > Hi, > When I use POV ray tracing in Chimera, it appears to ignore a > clipping plane (the rendered image is unclipped). Is there any way > around this? > Regards, > Ed

2 1

Scripting headless Chimera
by Evans, Mark 06 Jul '12

06 Jul '12

Hello, I am doing some epitope analysis and I am generating images of each potential epitope overlaid and colored on the antigen model. I have a script that loops through a list of residue sets (epitopes) and uses chimera to generate the images. The script works if I call it from within Chimera running on Mac OSX. I just installed the headless version on Redhat linux and was trying to modify my python script to run on the headless version and I ran into a few issues I would like some advice with. 1. Say I have ten sets of residues, which should produce 10 images. I get the first one, but then I get the following error: Traceback (most recent call last): File "/opt/bin/Chimera64-1.6.2rc/share/chimeraInit.py", line 686, in init midas_text.doRunScript("runscript", script) File "/opt/bin/Chimera64-1.6.2rc/share/Midas/midas_text.py", line 2037, in doRunScript execfile(scriptPath, scriptGlobals) File "batchEpitopeModel3.py", line 144, in <module> callChimera(data[ab][4],data[ab][5],fn,dn) File "batchEpitopeModel3.py", line 29, in callChimera rc("open " + trimer) File "/opt/bin/Chimera64-1.6.2rc/share/chimera/__init__.py", line 2426, in runCommand makeCommand(*args, **kw) File "/opt/bin/Chimera64-1.6.2rc/share/Midas/midas_text.py", line 69, in makeCommand f(c, args) File "/opt/bin/Chimera64-1.6.2rc/share/Midas/midas_text.py", line 1427, in doOpen modelArg, noprefs) File "<string>", line 1, in <module> File "/opt/bin/Chimera64-1.6.2rc/share/Midas/__init__.py", line 1937, in open raise MidasError('%s' % msg) MidasError: No such file or directory Error while processing 'batchEpitopeModel3.py': MidasError: No such file or directory File "/opt/bin/Chimera64-1.6.2rc/share/Midas/__init__.py", line 1937, in open raise MidasError('%s' % msg) It seems like Chimera terminated my script, even though it should be executing a loop. 2. The images that are generated on the Mac are large, hi-res pngs, but the images generated by the headless version are very small, low-res versions. I am not setting any image dimensions, are the defaults different between the two versions? Thanks for any help. I can post (or email directly) part of my python code if that is helpful. -Mark -This e-mail and any attachments may contain CONFIDENTIAL information, including PROTECTED HEALTH INFORMATION. If you are not the intended recipient, any use or disclosure of this information is STRICTLY PROHIBITED; you are requested to delete this e-mail and any attachments, notify the sender immediately, and notify the LabCorp Privacy Officer at privacyofficer(a)labcorp.com or call (877) 23-HIPAA / (877) 234-4722.

3 2

Surface rendering
by George Tzotzos 06 Jul '12

06 Jul '12

Hi everybody, I'm using SiteComp to detect differences in binding affinities between two similar structures. The _clusters.pdb file produced by SiteComp is a standard PDB file in which the grid points corresponding to the difference clusters are represented by hydrogen atoms. They can be treated as any molecule in Chimera. Usually I find it useful to represent them as a mesh surface. Usually, I load in Chimera the protein.pdb, the ligand.pdb and the _clusters.pdb. After this, I select the _clusters.pdb and show it as mesh or solid using Actions-> Surface. In some cases, I fail to render the surface, or to be precise only one part of the clusters is rendered. I understand that this is a frequent problem with this type of discontinuous pdb. I'm attaching one such file and I would be grateful for any help Best regards George

3 4

Generating binaries in Chimera Python
by Raju Purohit 06 Jul '12

06 Jul '12

Hello, I am working on SWIG which converts the functions written in C and C++ into their python equivalent which would be later used in Chimera. At one point while building binaries, I received an error message saying *extensions must be built with a compiler than can generate compatible binaries. Visual Studio 2003 was not found on this system.* So I believe installing Visual Studio 2003 must help building binaries. But since I will be actually working on Chimera Python, I wanted to know which compiler can generate compatible binaries in Chimera Python? Shall I go ahead with Visual Studio 2003? or any other version? Thank you in advance. -- Raju R.N. Third Year, B.Tech Mechanical Engineering National Institute of Technology Karnataka, Surathkal

2 1

how to use the command of "savepos" and "scene"
by Qinfen Zhang 05 Jul '12

05 Jul '12

Dear All I'd like to use the commond "savepos" or "scene" to save the maps' rotations and translations relative to input coordinates, etc., but when I used the command: ~savepos ****(a name I write) , or ~scene ***** There are errors reminder:No position named *****, or No scene named **** The versions I have tried include 1.6.1-linux_x86_64 and 1.6.2-linux_x86_64. Both of them have same problems. Could you kindly tell me how to use the savepos or scene, or how to resolve my problems? Millions thanks Qinfen ************************************************ （Qinfen Zhang）（Ph.D） Bio.EM.Lab,School of Life Science, Zhongshan（Sun Yat－sen） University Guangzhou, 510275,P.R.China Tel:86-020-84112286(Lab) http://scholar.google.com/citations?user=Wj62cPoAAAAJ&hl=en http://sklbc.sysu.edu.cn/Team/User/info.aspx?typeid=283&pid=80 http://bioem.sysu.edu.cn ************************************************

2 5

Re: [Chimera-users] question about surface properties in Chimera
by Elaine Meng 05 Jul '12

05 Jul '12

Hi Katie, The hydrophobicity coloring in the presets menu is simply using the Kyte-Doolittle amino acid hydrophobicity values. That is, all the surface patches belonging to a given amino acid residue type will have the same color, and the colors range from blue for the most hydrophilic through white to orange-red for the most hydrophobic. If you open Render By Attribute (under Tools... Structure Analysis) and set it to show the attribute of "residues" named "kdHydrophobicity" you can apply a different coloring scheme to these same values. Or, if you want, you can write out a file that lists the residues in the protein and the associated values (in that tool's menu, use File... Save Attributes). That will include all the residues, though, not just the ones on the surface. <http://www.cgl.ucsf.edu/chimera/docs/ContributedSoftware/render/render.html…> However, as mentioned, it is merely a lookup based on the residue type. There is a table of Kyte-Doolittle hydrophobicity values here, and instructions for using different scales of amino acid hydrophobicity, if you would like: <http://www.cgl.ucsf.edu/chimera/docs/UsersGuide/midas/hydrophob.html> We encourage Chimera questions to be sent to chimera-users(a)cgl.ucsf.edu (Cc'd) unless the message includes private data. I hope this helps, Elaine ----- Elaine C. Meng, Ph.D. UCSF Computer Graphics Lab (Chimera team) and Babbitt Lab Department of Pharmaceutical Chemistry University of California, San Francisco On Jul 4, 2012, at 7:40 AM, Katherine Klymko wrote: > Dear Dr. Meng, > Hello--I am a theoretical chemistry student at Columbia University and I am interested in the hydrophobicity maps of proteins that Chimera generates: I know that this can be used to visualize the hydrophobicity of the surface, but does it also generate a file that I can use that lists the positions of the surface atoms or amino acids with their hydrophobic value? I am interested in quantitatively comparing the hydrophobic surface organization in a large number of proteins. > > I apologize if you are the wrong person to ask but when searching for solutions on line, you seemed to be the person that a lot of people went to for help. > Thank you, > Katie Klymko

2 2

just a word of appreciation
by Reut S. Abramovich 05 Jul '12

05 Jul '12

Hi, Just wanted to say i have been using chimera for the last 6 years or so, and enjoy it very much. I hope you will continue to improve this magnificent scientific tool - its doing a great job in balancing a logical, easy to use, user interface and providing the user with a lot of impressive capabilities, which i can run on my laptop (and thats important !!). I really think Chimera team should be congratulated not only on content and code writing, but also on project management. All the best ! -- Kind Regards, Reut S. Abramovich PhD candidate Australian Centre for Astrobiology University of New South Wales Room G13, Biological Sciences Building Kensington, NSW 2052, Australia Phone: (+61) 02 9385 2098 Cell: (+61) 0406 858 646

2 1

Error when exporting to obj format
by Vicente Díaz 05 Jul '12

05 Jul '12

Hi: I am trying to export a scene to obj format. I have tried this export with two different versions of chimera (1.5.3 and 1.6.1), and tried to open the resulting file in two different 3d programs: Cinema 4D and 3d studio max. Although both applications recognize the exported file, when they open it they dont find any content. In C4D, the file is an empty scene, while importer in 3ds max sends an error message telling that there are no objects to import. Therefore, it seems that the file is empty. I have seen that this kind exporting in Chimera is too fast (almost instantly) when compared to exporting to other file formats, like vrml, which take some time but work perfectly. Is there something I am doing wrong or an option I havent noticed to ensure export to obj file format? Thank you in advance, Vicente

4 4

Beta-turns and hairpins
by Kyle Morris 03 Jul '12

03 Jul '12

Dear all, Is there a simple way to model beta-turns and hairpins in polypeptide chains in Chimera? Thanks in advance for any assistance, Kyle

3 2

User Inquiry
by Yen Bui 02 Jul '12

02 Jul '12

To whom this may concern, I’m an undergraduate student doing some research at KSTATE this summer and I’ve been assigned to work on a project that utilizes Chimera. My professor is unavailable a lot of the time and I’ve been struggling a bit with a problem. I’ve been successful at opening up the following PDB files: 1DHK 1DPX 1HYL 2CAU 3BLG 1OA6 1JBC 1OA5 I’m able to open up the .pdb files, proceed to use the commands “del solvent” and “del @ .b” in the command line. I’m also able to go to ToolsàHigher Order Structure à Crystal Contacts before changing the contact distance from 1.0 to 4.0 and check mark the create copies of contacting molecules. However when I attempt to do the following actions for the rest of the proteins I run into a variety of issues: For example 2CAU: When I attempt to “measure buried area #0 # 2-7,” I get the following response in my reply log: #0, chain A: JACK BEAN vicilin 6 pairs of NCS asymmetric units of 2CAU contact at distance 1.0 A Atoms MTRIX SMTRY Unit cell MTRIXref Copies 1 0 4 0 0 0 0 1 1 0 5 0 0 0 0 1 1 0 6 -1 0 -1 0 1 1 0 8 0 0 0 0 1 1 0 9 0 0 -1 0 1 1 0 11 0 0 -1 0 1 C:\Program Files\Chimera 1.6.1\bin\mscalc.exe 1.400000 2.000000 1 MSMSLIB 1.3 started on Local PC Copyright M.F. Sanner (March 2000) Compilation flags C:\Program Files\Chimera 1.6.1\bin\mscalc.exe 1.400000 2.000000 1 MSMSLIB 1.3 started on Local PC Copyright M.F. Sanner (March 2000) Compilation flags C:\Program Files\Chimera 1.6.1\bin\mscalc.exe 1.400000 2.000000 1 MSMSLIB 1.3 started on Local PC Copyright M.F. Sanner (March 2000) Compilation flags C:\Program Files\Chimera 1.6.1\bin\mscalc.exe 1.400000 2.000000 0 MSMSLIB 1.3 started on Local PC Copyright M.F. Sanner (March 2000) Compilation flags C:\Program Files\Chimera 1.6.1\bin\mscalc.exe 1.400000 2.000000 0 MSMSLIB 1.3 started on Local PC Copyright M.F. Sanner (March 2000) Compilation flags C:\Program Files\Chimera 1.6.1\bin\mscalc.exe 1.400000 2.000000 0 MSMSLIB 1.3 started on Local PC Copyright M.F. Sanner (March 2000) Compilation flags C:\Program Files\Chimera 1.6.1\bin\mscalc.exe 1.400000 2.000000 0 MSMSLIB 1.3 started on Local PC Copyright M.F. Sanner (March 2000) Compilation flags [End of Reply Log] So I’m not able to get back the calculations I want. Also, when I attempt to use the Surface Analysis à Attributes Calculator to run the following function : sum(atom.buriedSASArea) and check the “Restrict formula domain to current selection, if any” and “Save calculation results to file,” after selecting the “C” atoms I get the reply: Formula evaluation error: expecting vector argument in function Is there something I need to do before I attempt these actions? Also, I have very little experience with programs in general (I’m a chemistry major/upcoming experimental chemist working with theortical physicist…a little out of my element). Thanks in advance, -Yen Bui

2 3

Alignment of symmetry axes via Chimera
by danashah＠post.tau.ac.il 02 Jul '12

02 Jul '12

Hi all, I've only joined this mailing list lately, so pardon me if this question was asked and answered before. We have two different peptides, each contains a 4-fold symmetry axis. We would like to align those two symmetry axes, without superimpose one peptide on the other, since they should be continuous. Is there a way to do that via Chimera (gui or no gui)? I was able to find this conversation: http://www.cgl.ucsf.edu/pipermail/chimera-users/2008-October/003140.html but it doesn't solve our specific situation. Best, Dana. __ Dana Sachayni Joel Hirsch's Lab Faculty of Life Sciences Tel Aviv University Ramat Aviv, Israel e-mail: danashah(a)post.tau.ac.il

2 1

Wrong formtting into pdb file after "Chimera"
by Hsih-Te Yang 29 Jun '12

29 Jun '12

Hello: By using "Chimera" under its environment, I retrieved the 3GBM from internet of PDB. Then "H" and "L" chains were selected and then combined into one model. The formats before and after using Chimera are different: Before and download from PDB: original 3GBM.pdb: -------------------------------------------------------------------------- ATOM 8198 N ILE H 52 21.400 -46.642 -15.670 1.00 34.21 N ATOM 8199 CA ILE H 52 21.907 -48.031 -15.705 1.00 34.50 C ATOM 8200 C ILE H 52 22.650 -48.325 -17.003 1.00 34.35 C ATOM 8201 O ILE H 52 22.192 -47.956 -18.089 1.00 34.71 O ATOM 8202 CB ILE H 52 20.781 -49.070 -15.662 1.00 34.67 C ATOM 8203 CG1 ILE H 52 19.817 -48.868 -14.495 1.00 35.26 C ATOM 8204 CG2 ILE H 52 21.375 -50.440 -15.579 1.00 36.91 C ATOM 8205 CD1 ILE H 52 20.481 -48.373 -13.235 1.00 36.77 C ATOM 8206 N PRO H 52A 23.772 -49.033 -16.926 1.00 34.41 N ATOM 8207 CA PRO H 52A 24.505 -49.283 -18.185 1.00 34.55 C ATOM 8208 C PRO H 52A 23.750 -50.255 -19.109 1.00 34.33 C ATOM 8209 O PRO H 52A 22.874 -51.013 -18.645 1.00 34.29 O ATOM 8210 CB PRO H 52A 25.817 -49.905 -17.709 1.00 34.19 C ATOM 8211 CG PRO H 52A 25.402 -50.687 -16.528 1.00 35.46 C ATOM 8212 CD PRO H 52A 24.336 -49.808 -15.815 1.00 34.63 C -------------------------------------------------------------------------- After using Chimera and saved as ".pdb" file: -------------------------------------------------------------------------- ATOM 371 N ILE H 52 -61.722 -45.711 -51.406 1.00 34.21 N ATOM 372 CA ILE H 52 -62.988 -46.402 -51.737 1.00 34.50 C ATOM 373 C ILE H 52 -63.058 -46.767 -53.215 1.00 34.35 C ATOM 374 O ILE H 52 -62.716 -45.957 -54.082 1.00 34.71 O ATOM 375 CB ILE H 52 -64.219 -45.520 -51.499 1.00 34.67 C ATOM 376 CG1 ILE H 52 -64.272 -44.923 -50.094 1.00 35.26 C ATOM 377 CG2 ILE H 52 -65.457 -46.324 -51.739 1.00 36.91 C ATOM 378 CD1 ILE H 52 -63.739 -45.839 -49.022 1.00 36.77 C ATOM 379 N PRO H 52 -63.548 -47.961 -53.533 1.00 34.41 N ATOM 380 CA PRO H 52 -63.580 -48.321 -54.966 1.00 34.55 C ATOM 381 C PRO H 52 -64.618 -47.494 -55.747 1.00 34.33 C ATOM 382 O PRO H 52 -65.552 -46.927 -55.145 1.00 34.29 O ATOM 383 CB PRO H 52 -63.975 -49.797 -54.948 1.00 34.19 C ATOM 384 CG PRO H 52 -64.891 -49.879 -53.793 1.00 35.46 C ATOM 385 CD PRO H 52 -64.271 -48.943 -52.718 1.00 34.63 C -------------------------------------------------------------------------- The "52A" -> "52", there is no discrimination between "ILE" and "PRO" on the position 52 of H chain. Please let me know, what wrong with my data processing? Thank you a lot. Hsih-Te

2 2

Untranslating after using solvate
by Matthew Baumgartner 29 Jun '12

29 Jun '12

Hello, I am using chimera to add a shell of water around a given protein using the solvate command through the command line. However, upon adding solvent, the protein is translated/rotated a bit, as mentioned in the documentation ( file:///opt/UCSF/Chimera64-1.6/share/chimera/helpdir/ContributedSoftware/solvate/solvate.html <cid:part1.03060408.05020907@pitt.edu>). However, I would like to leave the protein in it's input coordinates and simply add waters around it. Is there a way to use the solvate command without translation? If not, how should I go about resetting the structure back to it's original coordinates? Thanks, Matt Probably unnecessary details: Running: USCF Chimera, production version 1.6 (build 35700) Under: Ubuntu 12.04 64-bit

2 2

Chimera registration
by Sébastien POMEL 28 Jun '12

28 Jun '12

Hi, I tried to register because my registration has expired but when I enter my informations it says that I have to enter my last name first, and then my first name. I did not make any mistake but it keeps saying this. Could you help me? Thank you Sébastien Pomel Sébastien POMEL, Ph.D. Antiparasitic Chemotherapy Group UMR CNRS 8076, Faculty of Pharmacy, University PARIS XI, 5 rue Jean-Baptiste Clément, 92296, CHATENAY-MALABRY CEDEX FRANCE Tel : +33 (0)1-46-83-52-84 Fax : +33 (0)1-46-83-55-57

2 1

Phases of the 3D FFT
by Denis Chrétien 28 Jun '12

28 Jun '12

Dear all, I'm new to this list, so maybe this question has been raised previously. Sorry if this is the case. We are using the capability of Chimera to perform 3D Fourier transforms, in order to analyse the effect of the missing wedge on cryo-electron tomograms of microtubules. The "layer lines" of the microtubules are nicely revealed in 3D, showing rings corresponding to the amplitudes of their FFT. Yet, it would be really nice to have the phases displayed, e.g. using colors. Would that be possible to be implemented into the "vop Fourier" command of Chimera? Best, Denis ___________________________ Université de Rennes 1 UMR 6290, équipe TIPs Campus de Beaulieu, Bât. 13 35042 Rennes Cedex France Tel. +33 (0)2 23 23 67 64 http://equipes.igdr.univ-rennes1.fr/fr/tips/ ___________________________

2 1

Clustering docking results using "headless" Chimera
by Hurt, Darrell (NIH/NIAID) [E] 28 Jun '12

28 Jun '12

Hi there, I want to use Chimera on a server (or in an automated fashion by command line; "-nogui") to read in a bunch (1000s) of PDB structures (each having an identical number of atoms) and then do clustering using the NMRCLUST code that you've so conveniently adapted. I found this old thread: http://www.cgl.ucsf.edu/pipermail/chimera-users/2008-October/003193.html Is this still the preferred method for doing what I'm hoping? Also, is it possible to do a MatchMaker alignment before the clustering? Thanks, Darrell -- Darrell Hurt, Ph.D. Section Head, Computational Biology Bioinformatics and Computational Biosciences Branch (BCBB) OCICB/OSMO/OD/NIAID/NIH 31 Center Drive, Room 3B62B, MSC 2135 Bethesda, MD 20892-2135 Office 301-402-0095 Mobile 301-758-3559 http://bioinformatics.niaid.nih.gov<http://bioinformatics.niaid.nih.gov/> (Within NIH) http://exon.niaid.nih.gov<http://exon.niaid.nih.gov/> (Public) Disclaimer: The information in this e-mail and any of its attachments is confidential and may contain sensitive information. It should not be used by anyone who is not the original intended recipient. If you have received this e-mail in error please inform the sender and delete it from your mailbox or any other storage devices. National Institute of Allergy and Infectious Diseases shall not accept liability for any statements made that are sender's own and not expressly made on behalf of the NIAID by one of its representatives.

2 4

change movie frame directory
by Trina Manalo 28 Jun '12

28 Jun '12

Hi all, We're having problems changing the directory where movie frames are saved to a separate drive (We installed Chimera on an SSD with limited space). In the movierecorder dialog box, we added Additional recording options: directory E:\Chimera_frames Additional encoding options: resetMode keep And got the following error: MidasError: Directory E:\Chimera_frames does not exist File "E:\Chimera 2012-06-28\share\MovieRecorder\moviecmd.py", line 84, in record_op raise CommandError('Directory %s does not exist' % (directory,)) Any advice? -Trina

2 1

Cannot open the .pdb file generated from ZDOCK
by Hsih-Te Yang 27 Jun '12

27 Jun '12

Good morning, all: Attached is the output file generated by "ZDOCK". I couldn't open it by "Chimera", but "RasMol" was working. What wrong with this? Any comment and reply are greatly appreciated. Hsih-Te Yang

2 2

atom type labels ?
by Marek Maly 26 Jun '12

26 Jun '12

Hello, is there any way how to obtain atom-type labels when loading molecular structure using *.prmtop and *.inpcrd/*.rst/*.mdcrd Amber files ? These atom types are indeed available in *.prmtop file, but I didn't know how to visualize them in Chimera. I was hoping to find this possibility under "Actions->Label->other..." but I didn't find this item on the actual list. Thanks in advance for any comment ! Best wishes, Marek -- Tato zpráva byla vytvořena převratným poštovním klientem Opery: http://www.opera.com/mail/

2 1

Electrostatic potential
by George Tzotzos 26 Jun '12

26 Jun '12

Hi everybody, Assuming that one knows the precise residues constituting a binding site, it is possible to calculate the electrostatic potential of these residues only? If yes, how? Thanks for any advice George

5 7

Peptide Optimization
by Gustavo Souza 22 Jun '12

22 Jun '12

Hello! has anybody has a clue for a method to optimize a peptide structure (12 aa) using Chimera? thanks for help! Gus.

2 1

help with how to save a volumes
by Sara Sandin 20 Jun '12

20 Jun '12

Hi, Thank you for a great software :) I have one problem. I have two em density maps in spider format. After I have used the fit in map option and one density has been rotated and shifted, how do I save a new spider file with the applied rotation and translation? Thank you, Sara -- Division of Structural Studies MRC Laboratory of Molecular Biology Hills Road Cambridge CB2 0QH UK ssandin(a)mrc-lmb.cam.ac.uk

2 2

stick scale
by FABRE, BENJAMIN 19 Jun '12

19 Jun '12

Helo, I am a new user of chimera. I would to change the stick scale of a single residue of one protein. How can I do this? Should I create different models to do this? Thank you. Benjamin Fabre

2 2

Need help for using Chimera
by A-A_lowie li 18 Jun '12

18 Jun '12

Dear Sir: I am a new user of Chimera, but immediately attracted by this handy software Chimera. Since my model requires a lot of computation time in energy minimization, could you please how to set up the environment for parallel computation of energy minimization in Chimera? On one website, it was said, MMTK ENERGY THREADS could be reset for parallel computation. After installation of MMTK, I am confused on how to change parameter in MMTK, and recompile Chimera (or change Chimera settings ). Could you please give me more details about how to set MMTK ENERGY THREADS in Chimera? Sincerely thanks for your advice. Lowie -- Without dream, life is incomplete!

2 4

Re: [Chimera-users] Chimera movie
by Elaine Meng 18 Jun '12

18 Jun '12

On Jun 18, 2012, at 3:40 PM, Vladimir Kuznetsov wrote: > Hi Elaine, > I'm trying to make a movie using Chimera. The basic outline is as follows: a homo-dimer is dissociating into monomers, then focus on one of the monomers rearranging into a compact form. I think I could record the dissociation step with "savepos/fly" option, and morphing works for the second step. Is it possible to stitch them together for a single QuickTime file? > Thank you for your time, > Vlad Kuznetsov > (Sacchettini lab, Texas A&M University) Hi Vlad, Instead of combining two movie files into one movie file (it must be possible, but I don't have experience with that), I would just do everything in one Chimera movie content script. You could either do the savepos and morphing in the same or a different script before starting recording, or do it interactively and save the session. Then restore session if you had saved a session, and execute your recording script, in which you can use fly and other movement commands (move, turn, ...) as well as the coordset command to play the morph. <http://www.cgl.ucsf.edu/chimera/docs/UsersGuide/movies.html> There is an example movie and associated Chimera script in the Animation Gallery, see "Ball-and-socket motion" currently the 6th one down: <http://www.cgl.ucsf.edu/chimera/animations/animations.html> I cc'd chimera-users(a)cgl.ucsf.edu since this answer might help others (it's generally better to send questions there than to me directly, unless you are including private data). Good luck with making a beautiful movie! I hope this helps, Elaine ---------- Elaine C. Meng, Ph.D. UCSF Computer Graphics Lab (Chimera team) and Babbitt Lab Department of Pharmaceutical Chemistry University of California, San Francisco

1 0

Measuring Beta Barrels
by Danielle L'Heureux 18 Jun '12

18 Jun '12

Hi - We are using Chimera to analyze fluorescent proteins, and we want to cluster and compare the barrels of each protein by examining a cross section of the FP beta barrel. Is there a way to measure the ellipsoid shape of a "slice" of a protein? Or is there a way to create an elliptical plane from which we can then calculate the area? Thank you, Danielle L'Heureux

3 2

Chimera System Requirments: Details Solicited
by sunny kumar 14 Jun '12

14 Jun '12

Hi All, I have been trying to figure out the system requirments before installing Chimera, on my laptop. Would request you to please share the minimum processor speed, RAM, OS and hard-disk requirments for optimum results on chimera-1.6.1-win32.exe. I am currently using an HP laptop with XP Operating System, Intel Core 2 Duo Processor, 1 GB RAM and 60 GB hard-disk. Thanks for the help. Regards, Sunny Kumar

3 2

Re: [Chimera-users] Ellipsoids for 800 pdbs
by Elaine Meng 14 Jun '12

14 Jun '12

On Jun 14, 2012, at 4:54 AM, mselvaraj(a)mbu.iisc.ernet.in wrote: > Dear Meng, > I need to calculate ellipsoid axis for some 800 pdbs that I have in a > directory using measur inertia command. I was trying to load one by one and > calcualte, but I was huge. I read about python script for running in > batches. Is there any chimera script for doing this?. I would like to get > your help in doing this. Thanks in advance. > > Yours sincerely, > M. Selvaraj, > Graduate student, > Molecular Biophysics Unit, > Indian Institute of Science, > Bangalore 560 012. Dear M. Selvaraj, The Chimera Programmer's Guide includes a primer on how to write a python script to process multiple structures: <http://www.cgl.ucsf.edu/chimera/docs/ProgrammersGuide/basicPrimer.html> It is better to send Chimera questions to chimera-users(a)cgl.ucsf.edu (or if advanced programming issues, to chimera-dev(a)cgl.ucsf.edu) instead of to me directly. I hope this helps, Elaine ---------- Elaine C. Meng, Ph.D. UCSF Computer Graphics Lab (Chimera team) and Babbitt Lab Department of Pharmaceutical Chemistry University of California, San Francisco

1 0

addH: Weird results
by George Tzotzos 11 Jun '12

11 Jun '12

Hi everybody, For several months I have been saving docking results from Autodock, adding hydrogens and submitting them to Amber for molecular dynamics. Chimera worked perfectly well. A typical result is attached as <file1.pdb>. I repeated the process with a different pose of the same ligand and got very weird results. In fact the atoms were numbered differently and some atoms were not numbered at all, or rather they were given ***. I submitted some of the original ligands, that is the ligands to which Chimera added Hs correctly. A typical example is attached <docking.result_8_2.pdb>. The result of <file1.pdb> was not reproduced. The errors described above were repeated (see <file2.pdb>). Trying to renumber the atoms according to <file1.pdb> did not help. I am a bit baffled by this. Any help will be most welcome. Best regards George PS. The submitted ligand is bisabolol.

2 3

TER characters between residues in exported PDB ?
by Marek Maly 07 Jun '12

07 Jun '12

Hello all, I would like to know if there is any way how to export from Chimera molecular structure in PDB format but with TER string between all residues in the file. This would be very helpful if one prepares in Chimera PDB inputs (containing also non protein or non DNA/RNA molecules) for Amber because Amber (Leap) automatically tries to create bonds between all consecutive residues unless they are separated by TER string. Thank you very much for any useful information. Best wishes, Marek -- Tato zpráva byla vytvořena převratným poštovním klientem Opery: http://www.opera.com/mail/

3 11

error in add chain ID
by Hamzeh, Rahimi 07 Jun '12

07 Jun '12

Dear Eric use I want rename_pdb_for_chimera.py for adding chain ID to pdb file but i got following erro. buksanbio@hamzeh:/media/6C166CAD166C7A4A/kit/zdock/apc10-apc3$ python rename_pdb_for_chimera.py 1 avgapc10final.pdb File "rename_pdb_for_chimera.py", line 100 there's a chain identifier in the "TER" line... (the condition len ^ IndentationError: expected an indented block Please let me know about my wrong best wish

2 1

Re: [Chimera-users] undisplay label in distance monitor
by Bala subramanian 07 Jun '12

07 Jun '12

Friends, > I have written a script to draw lines between atoms (using distance > monitor). I dnt want the distance label to be displayed with the pseudo > bond. Kindly write me the way to remove the label. My script is below. > > model=chimera.openModels.open('myavg.pdb') > res=model[0].residues > MAT=loadtxt('mymatrix',dtype=float) > chimera.runCommand('focus') > for x in range(len(res)): > for y in range(len(res)): > if x <> y : > value=MAT[x,y] > > if 0.5 < value > 0.75: > > b=distanceMonitor.newPseudoBond(res[x].atomsMap['CA'][0],res[y].atomsMap['CA'][0]) > b.drawMode=1 > b.radius=0.05 > #b.label=None I tried keeping this value as None and empty > string but it doesnt help. > b.color=getColorByName('red') > > else: pass > > else: continue > > Thanks, Bala -- C. Balasubramanian

2 3

index out of range
by Francesco Pietra 06 Jun '12

06 Jun '12

Running movie for prmtop/dcd proved extremely slow at amd64, finally showing the protein in a water box, albeit offering very limited analysis. Error message: index out of range, error processing "monitor changes". The log is 16MB!, below the startr and end of the log: MDTools 1.2 Exp (2005-08-20) by James Phillips. Trajectory.DCD.MDToolsMarch97.md.help() for more info. HomoCoord 1.3 Exp (2005-08-20) - Constants 1.1 Exp (2004-05-17) - AtomGroup 1.4 Exp (2007-02-07) - local 1.1 Exp (2004-05-17) Unknown OSTYPE ??? set. Viewing and plotting are disabled. - Trans 1.2 Exp (2005-08-20) - DCD 1.10 Exp (2007-02-07) - Data 1.2 Exp (2005-08-20) using memory mapping REMARKS FILENAME=./heat-01.dcd CREATED BY NAMD REMARKS DATE: 06/03/12 CREATED BY USER: francesco Model 0 (heat-01.dcd) appears to be a protein without secondary structure assignments. Automatically computing assignments using 'ksdssp' and parameter values: energy cutoff -0.5 minimum helix length 3 minimum strand length 3 Use command 'help ksdssp' for more information. Traceback (most recent call last): File "/usr/local/chimera_Nov3.2011/share/chimera/triggerSet.py", line 83, in invoke self._funcData, triggerData) File "/usr/local/chimera_Nov3.2011/share/chimera/Sequence.py", line 1161, in _cacheCheck if len(kids) == molecule.rootForAtom(kids[0], IndexError: list index out of range Error processing trigger "monitor changes": .................................... .................................... Traceback (most recent call last): File "/usr/local/chimera_Nov3.2011/share/chimera/triggerSet.py", line 83, in invoke self._funcData, triggerData) File "/usr/local/chimera_Nov3.2011/share/chimera/Sequence.py", line 1161, in _cacheCheck if len(kids) == molecule.rootForAtom(kids[0], IndexError: list index out of range Error processing trigger "monitor changes": IndexError: list index out of range File "/usr/local/chimera_Nov3.2011/share/chimera/Sequence.py", line 1161, in _cacheCheck if len(kids) == molecule.rootForAtom(kids[0], See reply log for Python traceback. Thanks for the attention francesco pietra

2 2

transparency for surface in intersurf
by Jean-Didier Maréchal 06 Jun '12

06 Jun '12

Hi guys, is there a way to change the transparency of intersurf objects? I'd like to have the surface not hiden all the object in behing one given view. thanks a lot, cheers jd Dr. Jean-Didier Maréchal Lecturer The Computational Biotechnological Chemistry Team Unitat de Química Física Departament de Química Universitat Autònoma de Barcelona Edifici C.n. 08193 Cerdanyola (Barcelona) Tel: +34.935814936 e-mail: JeanDidier.Marechal(a)uab.es www: http://asklipio.qf.uab.es

2 2

fitmap
by Hernando J Sosa 05 Jun '12

05 Jun '12

HI, What is the correct syntax to run the fitmap command?. I have a pdb structure named C1 and a density map (spider format) named MV (names as appear in the Model panel). If I try in the command line: fitmap C1 MV I get the error: fitmap invalid volume argument "MV" What am I doing wrong? Thanks

3 5

Fwd: ESP calculations
by Eric Pettersen 05 Jun '12

05 Jun '12

Begin forwarded message: > From: Nikolay Igorovich Rodionov <nirodion(a)syr.edu> > Date: May 21, 2012 12:43:34 PM PDT > To: Eric Pettersen <pett(a)cgl.ucsf.edu> > Subject: RE: [Chimera-users] ESP calculations > > Thank you both, > > Can either of you tell me how the information in a volume data set > is organized? I am looking at a .dx file that I created using APBS > which I would assume to be very similar to the volumetric data sets > created by Chimera. What does each column of data represent? Is > there any way for me to sort the ESP data based on position using > Excel or Matlab? I am only concerned with ESP data for one region of > molecule. If you could point me in the direction of some good > documentation on this file type it would be great. I don't know, so I'm forwarding this out to chimera-users land, where someone might have an answer... --Eric > > Thanks again, > Nikolay Rodionov > > -----Original Message----- > From: Eric Pettersen [mailto:pett@cgl.ucsf.edu] > Sent: Monday, May 21, 2012 2:57 PM > To: chimera-users(a)cgl.ucsf.edu BB > Cc: Nikolay Igorovich Rodionov > Subject: Re: [Chimera-users] ESP calculations > > Also, if you compute a volume, you can use the "Values at Atom > Positions" tool to, um, get the values at atom positions (say, a > ligand), if that's relevant to what you're doing. > > --Eric > > On May 21, 2012, at 9:09 AM, Elaine Meng wrote: > >> Hi Nikolay, >> You can generate a grid of values with the "Compute grid" option of >> Coulombic Surface Coloring (or corresponding option of the >> "coulombic" >> command). The grid is a volume data set, and when it is generated >> the >> Volume Viewer and Surface Color dialogs will automatically appear. >> >> <http://www.cgl.ucsf.edu/chimera/docs/ContributedSoftware/coulombic/ >> co >> ulombic.html >>> >> <http://www.cgl.ucsf.edu/chimera/docs/ContributedSoftware/coulombic/ >> co >> ulombic.html#volume >>> >> >> You can save the grid to a file with the FIle menu of Volume Viewer. >> <http://www.cgl.ucsf.edu/chimera/docs/ContributedSoftware/ >> volumeviewer >> /framevolumeviewer.html >>> >> >> As for the values at each point of the surface, I don't know of a way >> to write these all to a file, but in Surface Color if you click the >> Options button and then turn on the option to "Report value at mouse >> position" it will report the values in the status line at the bottom >> of the Chimera window when you click into the graphics window and >> then >> mouse over the surface. I just noticed that to make this work it is >> necessary to recolor the surface first by clicking the Color button >> on >> this dialog, which may be a bug, but that's the workaround! >> <http://www.cgl.ucsf.edu/chimera/docs/ContributedSoftware/surfcolor/ >> su >> rfcolor.html >>> >> >> If you have the grid file saved you can reopen it in Chimera later >> and >> use it in Surface Color without rerunning the ESP calculation. >> >> However, keep in mind that Coulombic ESP is more for qualitative >> purposes of visualization or making comparisons between related >> structures than for absolute quantitative accuracy. For example, you >> could easily make all the ESP values half as large simply by doubling >> the dielectric constant used in their calculation, as shown in the >> equation in the Coulombic Surface Coloring manual page. >> >> I hope this helps, >> Elaine >> ---------- >> Elaine C. Meng, Ph.D. >> UCSF Computer Graphics Lab (Chimera team) and Babbitt Lab Department >> of Pharmaceutical Chemistry University of California, San Francisco >> >> On May 21, 2012, at 8:05 AM, Nikolay Igorovich Rodionov wrote: >> >>> Hi all, >>> I was wondering if there was a way to get an output data file >>> regarding ESP coloring and calculations based on Coulomb's law. The >>> visualization is great but I would also like to quantify the data. >>> Thank you, >>> Nikolay Rodionov >> >> >> _______________________________________________ >> Chimera-users mailing list >> Chimera-users(a)cgl.ucsf.edu >> http://plato.cgl.ucsf.edu/mailman/listinfo/chimera-users >> > > > >

3 2

ESP calculations
by Nikolay Igorovich Rodionov 05 Jun '12

05 Jun '12

Hi all, I was wondering if there was a way to get an output data file regarding ESP coloring and calculations based on Coulomb's law. The visualization is great but I would also like to quantify the data. Thank you, Nikolay Rodionov

4 3

Question about animated Ramachandran plot
by Trina Manalo 04 Jun '12

04 Jun '12

Hello, I would like to create an animated Ramachandran plot using an MD trajectory. One approach I've considered is using a per-frame script to save Ramachandran plot images (i.e., using the model panel, its possible to create a plot and then save the image as a png) Is there a way to do this using commands? Or is there an easier way to animate a plot of phi and psi angles over time? Thank you very much, Trina

2 1

triggering events when findhbond finds a bond
by Anne Bowen 04 Jun '12

04 Jun '12

Hi, I currently have a "Per-Frame Command" set up (in the MD Movie dialog) that finds the H bonds (findhbond makePseudobonds true lineWidth 2.0 color green intramodel true intermodel false selRestrict any) every frame of a trajectory. Whenever a hbond is detected, I would like to turn the entire structure a different color just for that frame, and then have it go back to being colored by heteroatom. Is there an easy way to accomplish this? I tried to look through the documentation to determine if "findhbond" could return true or false if an h bond was found and it did not seem like it was possible. Is the only way to do this to change the findhbond script itself? Any help or suggestions is greatly appreciated! Thank you, Anne

2 1

bond transparency as a function of length?
by Kersey Black 04 Jun '12

04 Jun '12

Hi, Very recent to Chimera. Trying to set the transparency of a bond to be a function of bond length in each frame of a trajectory. I have figured out how to define a transparent color, and now I am imaging the solution might use something like range color to vary the blending of the opaque version of the color and the fully transparent version based on distance, with the distance being determined as a per frame attribute of those atoms, but someplace around here I am lost. Any hints, links or suggestions would be very much appreciated. Cheers, KB

2 3

Re: [Chimera-users] [chimera-dev] Rotating about an axis with mouse
by Elaine Meng 04 Jun '12

04 Jun '12

Hi Patrick, If I understand correctly, you can do what you want with "Constrained Move" (in menu under Tools... Movement): <http://www.cgl.ucsf.edu/chimera/docs/ContributedSoftware/constrained/constr…> (The purpose of "Movement Mouse Mode" is different, mainly to allow moving subparts of a model. By default, mouse manipulation moves whole models.) You can also specify center and axis of rotation if using commands (turn, roll). <http://www.cgl.ucsf.edu/chimera/docs/UsersGuide/midas/turn.html> <http://www.cgl.ucsf.edu/chimera/docs/UsersGuide/midas/roll.html> I hope this helps, Elaine ---------- Elaine C. Meng, Ph.D. UCSF Computer Graphics Lab (Chimera team) and Babbitt Lab Department of Pharmaceutical Chemistry University of California, San Francisco On Jun 4, 2012, at 6:28 AM, ladam wrote: > Hi all, > I have a python script that allows me to rotate a residue in a molecule > of a desired angle around a predefined vector. > Now I'd like to be able to do this graphically with the mouse on a selected > residue. > I have almost found what I want if I use the 'Move selection' option in the > 'Movement Mouse mode' but this does rotate around the center of Mass or > geometric center, not around a vector. > What I plan to do is derive the code from the corresponding /share/MoveSelection/move.py > module and try to insert a vector instead of the center_of_rotation(self.movable_groups) > but there is maybe a better, simpler idea. > Any suggestion? > Thanks a lot > -------------------------------- > Patrick Ladam > Maître de Conférence > Université Paris 13 - UFR SMBH > CSPBAT - Service RMN > 74, rue Marcel Cachin > 93017 Bobigny Cedex > Tel: 01 48 38 73 25 > Fax: 01 48 38 77 77 > mail: ladam(a)smbh.univ-paris13.fr > -------------------------------

1 0

make selection disappear smoothly
by Thomas Evangelidis 01 Jun '12

01 Jun '12

Dear Chimera developers, Simple question: is there any way to make a selection disappear smoothly during a movie? Thanks, Thomas

2 1

copy & paste multiple commands
by Thomas Evangelidis 01 Jun '12

01 Jun '12

Dear Chimera developers, This is an elementary question, but after searching a while in the mailing list and the documentation, I couldn't find the answer. So the question is if it is possible to copy & paste multiple commands in a single line into the Chimera command line interface. Alternatively, is the any "end of line" character that designates the end a of one command and the start of the next one? Thanks in advance, Thomas

2 1

pH based conformational change
by Nikolay Igorovich Rodionov 01 Jun '12

01 Jun '12

Hi all, Is there any way in Chimera to model protein denaturation across various pH values? Thanks Nikolay Rodionv

2 1

Re: [Chimera-users] Interpreting field / force direction in Coulombic Surface Coloring
by Elaine Meng 01 Jun '12

01 Jun '12

Hi Sumitro, The interaction energy of a "test" charge at some point would be the charge multiplied by the electrostatic potential. So if the test charge is -1 e (like one electron) its interaction energy at a point with potential +10 kcal/(mol.e) would be favorable, -10 kcal/mol. Positive potential favors interaction with negative charges and vice versa. I hope this clarifies, Elaine ----- Elaine C. Meng, Ph.D. UCSF Computer Graphics Lab (Chimera team) and Babbitt Lab Department of Pharmaceutical Chemistry University of California, San Francisco P.S. better to send questions to chimera-users(a)cgl.ucsf.edu because if you send to me and I'm on vacation, you might not get answered On May 18, 2012, at 12:36 AM, Sumitro Harjanto wrote: > Hi Elaine, > I have a simple question regarding the Coulombic Surface Coloring. I understand that the potential are generated by assuming a charged probe that moves along the surface of the model and as it traverses the surface the potential is picked up as the calculated electrostatic force the probe should experience (that's my understanding, correct me if I'm wrong please). > > I am just, however, a little confused about the interpretation of the value. say if I got a blue patch on the surface, which means I'm getting values in the range of ~10 (positive) kcal/(mol·e) at 298 K; does that mean the region indicated by the blue patch should potential attract or repel electron? > Thanks! > Cheers, > Sumitro

3 6

Visualization of terminal carboxylate
by George Tzotzos 26 May '12

26 May '12

This must be really trivial but I am asking nevertheless as I tried to no avail. I'm trying to visualise the terminal carboxylate oxygens. For example, I do: select :125@O :125@OXT and get 2 atoms selected. I then try to Actions Atoms/Bonds sphere. Nothing is shown. I would be grateful for any suggestions Regards George

2 1

PubChem Online Compound Search and Download
by Nancy 25 May '12

25 May '12

Hi All, I have been using the PubChem database to search for uncharged small molecules. However, even after specifying zero charge, PubChem still outputs compounds containing amino groups (-NH2) and carboxylic acids (-COOH); since I am interested in physiological pH, these compounds would actually be charged. Is there some way to exclude molecules containing these functional groups? I've noticed that there is an option on PubChem to include only certain atoms, but the search times out at 2 minutes if I try this. I'd like to exclude halogens and aldehydes as well, can this be specified? Finally, after searching for numerous compounds, how could all of them be downloaded into an organized compound library? If there is another online compound database besides PubChem that can be easily searched and has the same or better functionality, I'd greatly appreciate any info about it. Thanks, Nancy

2 2

water around protein
by Bala subramanian 25 May '12

25 May '12

Friends, I guess when i select no. of water as "sel ::WAT & protein z<3", i the distance of water is chosen as distance from atom protein atom centres. Instead i want to calculate no. of water around the protein Vdw surface with same distance value. Any idea would be of great help. Thanks, Bala

2 1

Re: [Chimera-users] Chimera-users Digest, Vol 109, Issue 28
by Boaz Shaanan 24 May '12

24 May '12

Hi, In answer to Nikolay's question about ESP values in various positions: 1) Elaine is absolutely right in pointing you to the APBS bb. If you look in their FAQ you'll notice that the question has been addressed several times. 2) There is an 'atompot' command that you can use when you run apbs. It'll print the values for each atom in the pdb, the only problem is that last time I tried it there were no atom names in output which was difficult for me (apbs team were supposed to add that feature) but x,y.z were there. 3) If atompot is not what you need somebody in the abps team will surely help you. Cheers, Boaz Boaz Shaanan, Ph.D. Dept. of Life Sciences Ben-Gurion University of the Negev Beer-Sheva 84105 Israel E-mail: bshaanan(a)bgu.ac.il Phone: 972-8-647-2220 Skype: boaz.shaanan Fax: 972-8-647-2992 or 972-8-646-1710 ________________________________________ From: chimera-users-bounces(a)cgl.ucsf.edu [chimera-users-bounces(a)cgl.ucsf.edu] on behalf of chimera-users-request(a)cgl.ucsf.edu [chimera-users-request(a)cgl.ucsf.edu] Sent: Thursday, May 24, 2012 10:00 PM To: chimera-users(a)cgl.ucsf.edu Subject: Chimera-users Digest, Vol 109, Issue 28 Send Chimera-users mailing list submissions to chimera-users(a)cgl.ucsf.edu To subscribe or unsubscribe via the World Wide Web, visit http://plato.cgl.ucsf.edu/mailman/listinfo/chimera-users or, via email, send a message with subject or body 'help' to chimera-users-request(a)cgl.ucsf.edu You can reach the person managing the list at chimera-users-owner(a)cgl.ucsf.edu When replying, please edit your Subject line so it is more specific than "Re: Contents of Chimera-users digest..." Today's Topics: 1. Fwd: ESP calculations (Eric Pettersen) 2. APBS output format (Elaine Meng) 3. Hydrogen bond energy calculation (Aditya Padhi) 4. Re: Hydrogen bond energy calculation (Elaine Meng) ---------------------------------------------------------------------- Message: 1 Date: Wed, 23 May 2012 13:18:14 -0700 From: Eric Pettersen <pett(a)cgl.ucsf.edu> To: "chimera-users(a)cgl.ucsf.edu BB" <chimera-users(a)cgl.ucsf.edu> Subject: [Chimera-users] Fwd: ESP calculations Message-ID: <4C557064-D2EC-45A5-9523-B35E683C76D5(a)cgl.ucsf.edu> Content-Type: text/plain; charset="us-ascii"; Format="flowed"; DelSp="yes" Begin forwarded message: > From: Nikolay Igorovich Rodionov <nirodion(a)syr.edu> > Date: May 21, 2012 12:43:34 PM PDT > To: Eric Pettersen <pett(a)cgl.ucsf.edu> > Subject: RE: [Chimera-users] ESP calculations > > Thank you both, > > Can either of you tell me how the information in a volume data set > is organized? I am looking at a .dx file that I created using APBS > which I would assume to be very similar to the volumetric data sets > created by Chimera. What does each column of data represent? Is > there any way for me to sort the ESP data based on position using > Excel or Matlab? I am only concerned with ESP data for one region of > molecule. If you could point me in the direction of some good > documentation on this file type it would be great. I don't know, so I'm forwarding this out to chimera-users land, where someone might have an answer... --Eric > > Thanks again, > Nikolay Rodionov > > -----Original Message----- > From: Eric Pettersen [mailto:pett@cgl.ucsf.edu] > Sent: Monday, May 21, 2012 2:57 PM > To: chimera-users(a)cgl.ucsf.edu BB > Cc: Nikolay Igorovich Rodionov > Subject: Re: [Chimera-users] ESP calculations > > Also, if you compute a volume, you can use the "Values at Atom > Positions" tool to, um, get the values at atom positions (say, a > ligand), if that's relevant to what you're doing. > > --Eric > > On May 21, 2012, at 9:09 AM, Elaine Meng wrote: > >> Hi Nikolay, >> You can generate a grid of values with the "Compute grid" option of >> Coulombic Surface Coloring (or corresponding option of the >> "coulombic" >> command). The grid is a volume data set, and when it is generated >> the >> Volume Viewer and Surface Color dialogs will automatically appear. >> >> <http://www.cgl.ucsf.edu/chimera/docs/ContributedSoftware/coulombic/ >> co >> ulombic.html >>> >> <http://www.cgl.ucsf.edu/chimera/docs/ContributedSoftware/coulombic/ >> co >> ulombic.html#volume >>> >> >> You can save the grid to a file with the FIle menu of Volume Viewer. >> <http://www.cgl.ucsf.edu/chimera/docs/ContributedSoftware/ >> volumeviewer >> /framevolumeviewer.html >>> >> >> As for the values at each point of the surface, I don't know of a way >> to write these all to a file, but in Surface Color if you click the >> Options button and then turn on the option to "Report value at mouse >> position" it will report the values in the status line at the bottom >> of the Chimera window when you click into the graphics window and >> then >> mouse over the surface. I just noticed that to make this work it is >> necessary to recolor the surface first by clicking the Color button >> on >> this dialog, which may be a bug, but that's the workaround! >> <http://www.cgl.ucsf.edu/chimera/docs/ContributedSoftware/surfcolor/ >> su >> rfcolor.html >>> >> >> If you have the grid file saved you can reopen it in Chimera later >> and >> use it in Surface Color without rerunning the ESP calculation. >> >> However, keep in mind that Coulombic ESP is more for qualitative >> purposes of visualization or making comparisons between related >> structures than for absolute quantitative accuracy. For example, you >> could easily make all the ESP values half as large simply by doubling >> the dielectric constant used in their calculation, as shown in the >> equation in the Coulombic Surface Coloring manual page. >> >> I hope this helps, >> Elaine >> ---------- >> Elaine C. Meng, Ph.D. >> UCSF Computer Graphics Lab (Chimera team) and Babbitt Lab Department >> of Pharmaceutical Chemistry University of California, San Francisco >> >> On May 21, 2012, at 8:05 AM, Nikolay Igorovich Rodionov wrote: >> >>> Hi all, >>> I was wondering if there was a way to get an output data file >>> regarding ESP coloring and calculations based on Coulomb's law. The >>> visualization is great but I would also like to quantify the data. >>> Thank you, >>> Nikolay Rodionov >> >> >> _______________________________________________ >> Chimera-users mailing list >> Chimera-users(a)cgl.ucsf.edu >> http://plato.cgl.ucsf.edu/mailman/listinfo/chimera-users >> > > > >

1 0

Hydrogen bond energy calculation
by Aditya Padhi 24 May '12

24 May '12

Dear Chimera users, I want to calculate the "energy or force" exerted between amino acid residues interacted by Hydrogen bonds throughout a total trajectory from MD simulation of a protein performed using Amber 10. (Example: H-bond between Isoleucine17-Asp15, Asp15-Ile46, Ile46-His13 etc, I want to calculate the H-bond interaction energy between these pair of residues and hence the net energy). I searched in the tutorials and literature but could not able to find any appropriate solutions. If anyone has the idea, please assist me finding the solution of this problem. Thanking you, Regards Aditya.

2 1

How to change the style of Hbonds
by Wendy Chu 20 May '12

20 May '12

Hello all, I am doing the Hbond analysis for my investigation. I found that the Hbonds are labeled as the solid line in the Chimera. But I prefer the dashed line. How to change it? Thank you~~~ -- Wen-Ting Chu State Key Laboratory of Theoretical and Computational Chemistry, Institute of Theoretical Chemistry, Jilin University, Changchun 130023, P. R. China

2 2

In Silico Compound Library Search
by Nancy 19 May '12

19 May '12

Hi All, Does anyone know of a free cheminformatic service from which it's possible to narrow down a search for molecules by inputting limits on their molecular parameters, such as molecular weight or the number of hydrogen bond donors, etc? Such a resource would be of great help. Thanks in advance, Nancy

1 0

How to place a metal ion in protein model
by Suneel N.A. 18 May '12

18 May '12

Hi Its my pleasure to introduce myself, I am Suneel, graduate student from India. I am not a bioinformatician by profession but a eager aspirant of learning bioinformatics. I am new to Chimera, but as I started using it, the desire for leraning Bioinformatics increased more and more. Chimera is such an awesome tool packed with so many options. I love it . I have small question for you. I have a predicted the structure of protein using in silico tools (based on homology modeling). Literature sates that this protein binds to Magnesium. Now I would like to know if I can use chimera to place the metal in the modeled structure and prove/validate it based on metal geometry. Please do the needful. Thanking you in anticipation yours sincerely suneel -- *Suneel Narayanavari. A* Graduate Student Prof. Manjula Sritharan's Laboratory of Infection Biology Department of Animal Sciences School of Life Sciences University of Hyderabad Hyderabad-46

6 12

Minimize Structure While keeping charges
by Michael Tomasini 17 May '12

17 May '12

Hello, I was wondering if there was a way to read in charges from a .mol2 file in order to use those charges in the minimize structure utility. By default, it seems that minimize structure adds charges which can be a rather time-consuming step. If I already have the charges in a .mol2 file, can these charges simply be used for the minimization? Thanks, Mike

3 2

Re: [Chimera-users] [Dock-fans] cofactors in dock
by Scott Brozell 17 May '12

17 May '12

Hi, On Wed, May 16, 2012 at 03:22:11PM +0530, Mary Varughese wrote: > I have to include the cofactor GTP as part of my receptor protein and dock > with a ligand. But chimera is not allowing to prepare rec_charged.mol2 file > since it fails at finding amibcc charge method for GTP residue. Then i > separately prepared the mol2 file for GTP (using gtp.prep and gtp.frcmod) > and after performing dockprep on the receptor i opened the GTP.mol2 file in > the same window and write the mol2 file. but again at grid generation it > fails "Reading in coordinates of receptor. > WARNING assign_vdw_labels: Atom valence violated for 1SA0.pdb (combined) > **** GTP 848 C8 13145. > Error reading in receptor." Which version of chimera are you using ? There was some recent activity for GTP but using Gasteiger charges: http://plato.cgl.ucsf.edu/pipermail/chimera-users/2011-October/006846.html Are you saying that you ran antechamber separately from chimera and got the am1bcc charges for gtp ? scott

2 1

PDB column overlap --PDB2PQR,APBS
by Nikolay Igorovich Rodionov 17 May '12

17 May '12

Hi all, I am trying do Poisson-Boltzmann calculations through outside software, PDB2PQR and APBS. I am prepare my initial pdb file in chimera using the 'write pdb' method. The final structure is quite large, 737058 atoms, so I am getting overlaps in the data columns after I write the PDB file. This doesn't create a problem for rendering the PDB file but I get parsing errors and other strange occurrences when I try to create a complementary PQR file. Does anyone know of a work around? Here are links to my structures, if you look you will see that a significant portion of the structure is getting cut off in the PQR. I can't seem to generate more than about 99760 atoms, no matter what I try. http://dl.dropbox.com/u/42179401/2TMV.18H.pdb http://dl.dropbox.com/u/42179401/2TMV.18Ha.pqr Can anyone think of a potential fix? I've experienced this same problem with smaller helix pdb files. Thank you, Nikolay Rodionov

3 9

improved movie tools
by Martin de Jonge 16 May '12

16 May '12

Hi, I recently published a tomographic reconstruction that was rendered using Chimera (see: http://www.pnas.org/content/107/36/15676.abstract) The movie that we were able to build using Chimera was excellent, but had to be recorded entirely in real time. That is, we had to turn on recording, manipulate the model, and turn off recording. I feel that it would be much easier if there was a nice interface to sequencing functionality. In this (as I imagine it) a sequence of particular views could be stored, and times specified for smooth transition from one element in the sequence ('view') to the next. These views could even be stored as saved sessions (if that helps with implementation). Please let me know if this functionality is already possible and (if so) please send me a sample! I note that my licence has expired; but when I try to renew it I run into problems with the server. Looking forward to your reply, Martin de Jonge Senior Scientist - XFM Australian Synchrotron p: (03) 8540 4195 | f: (03) 8540 4200 | m: 0488 338 594 800 Blackburn Road, Clayton, Victoria 3168 <br>This message and any attachments may contain proprietary or confidential information. If you are not the intended recipient or you received the message in error, you must not use, copy or distribute the message. Please notify the sender immediately and destroy the original message. Thank you.

3 2

RMSD between ensemble of a protein and its paralogue crystal structure
by Thomas Evangelidis 15 May '12

15 May '12

Dear UCSF Chimera developers, I want to calculate the RMSD between a MD trajectory of a protein and the crystal structure of its paralogue protein. I have looked though the Ensemble Match and RMSD Analysis pages but these applications work for the same proteins (correct me if I am wrong). Is there any way to provide an alignment file to Chimera and calculate the time series of the RMSD between the two paralogues? Thanks in advance, Thomas -- ====================================================================== Thomas Evangelidis PhD student Biomedical Research Foundation, Academy of Athens 4 Soranou Ephessiou , 115 27 Athens, Greece email: tevang(a)bioacademy.gr tevang3(a)gmail.com website: https://sites.google.com/site/thomasevangelidishomepage/

2 1

Addition of phosphates to PDB structures
by Donado, Carlos 14 May '12

14 May '12

Hi all, I would like to learn how to add a phosphate group to a particular residue, resembling phosphorylation of a particular residue, to a PDB structure. If this is doable using Chimera I would really appreciate any hints on how to do this. Also, I am new to Chimera but I was wondering if there was a way of adding ATP to a designated ATP binding site. I would very much appreciate any responses, Thanks, Carlos Donado The information in this e-mail is intended only for the person to whom it is addressed. If you believe this e-mail was sent to you in error and the e-mail contains patient information, please contact the Partners Compliance HelpLine at http://www.partners.org/complianceline . If the e-mail was sent to you in error but does not contain patient information, please contact the sender and properly dispose of the e-mail.

4 8

Re: [Chimera-users] semi-transparent ribbon behind semi-transparent surface
by Tom Goddard 14 May '12

14 May '12

Hi Sumitro, I made an image in the style of your image (1a0m.jpg below) using Chimera 1.6.1 and I think it captures the effect of your Chimera 1.5 image (ep.png) very well. The difference is that in your image where the ribbon crosses itself you can sometimes see through the top ribbon. Actually the top ribbon is only transparent in your image in about half of the crossings due to a Chimera 1.5 ribbon transparency bug. In the Chimera 1.6.1 image the ribbon is fully opaque so you do not see through it at places where it crosses itself. I think this produces a better image with less visual depth confusion. Also I think adding silhouette edges as I did in 1a0m_edges.jpg below improves the perception of ribbon crossovers further. I think the main virtue of your image is that the ribbon that is further back is lighter in color so it draws less attention. That is achieved by depth cueing which is the same in Chimera 1.6 and 1.5. My image perhaps does not illustrate depth cueing as well as yours since I used a different PDB model (didn't have yours) and in my view it doesn't vary as much in depth. Tom -------- Original Message -------- Subject: Re: [Chimera-users] semi-transparent ribbon behind semi-transparent surface Date: Sun, 13 May 2012 18:19:39 +0800 From: Sumitro Harjanto To: Tom Goddard Hi Tom, I've attached an image, it's something like this, can you view it? thanks! cheers, Sumitro On 12 May 2012 00:58, Tom Goddardwrote: Hi Sumitro, It is hard to completely understand your problem without seeing an example image made with Chimera 1.5 using the technique you described. If you provide such an image we might have suggestions about how to make something very similar in the latest Chimera. The image link you send before gives permission denied. Tom > Hi Elaine, > > thanks for the reply. I believe you exactly described what I did > with this paragraph: > "In Chimera 1.5 each surface could have its own single-layer > transparency. Thus you could still have multiple transparent > layers overall, but only the top layer of each surface. I'm > guessing the image is something like that (I don't have permission > to view it)." > Sadly, I resorted to re-installing CHIMERA 1.5 cos even if I use > pastel colours in Chimera 1.6, the effects were far from what I've > got using the multiple-single layer transparency previously. Is > there any plan to make the transparency setting more customisable > in the future? that will be of great help! thanks! > > Cheers, > Sum > > On 4 May 2012 00:18, Elaine Meng wrote: > > > On May 3, 2012, at 8:05 AM, Sumitro Harjanto wrote: > > > Hi Elaine, > > I used to use CHIMERA 1.5 to generate some molecular images. > and I was able to show a "hint of shadow" of ribbon behind a > semitransparent molecular surface. but I realised that I can > no longer do that from Chimera 1.6 onwards. I have tried > fiddling with the new "single layer transparency" value, but > either option did not provide me with the visual effect that I > could previously get in chimera 1.5. when I turned off the > single layer transparency, the molecular surface became very > messy with multiple shades and the color is visibly darker. > but If I leave it on, the semi-transparent ribbon was not > displayed at all. is there anyway that I can achieve a similar > effect in Chimera 1.6? i.e if you're wondering what effect I > am talking about here is an example: > http://onlinelibrary.wiley.com/store/10.1002/emmm.201200213/asset/image_n/n… > <http://onlinelibrary.wiley.com/store/10.1002/emmm.201200213/asset/image_n/n…> > > Thanks, Elaine! > > Cheers, > > Sumitro > > Hi Sumitro! > In Chimera 1.5 each surface could have its own single-layer > transparency. Thus you could still have multiple transparent > layers overall, but only the top layer of each surface. I'm > guessing the image is something like that (I don't have > permission to view it). > > In Chimera 1.6 the choices are only either a single layer of > transparency, or all transparent layers. > > In Chimera 1.5 if you turn off single-layer transparency for > each surface, the result is the same as in Chimera 1.6 if you > turn off global single-layer transparency. However, I realize > that does not help, since you don't want to show all layers > (it's often ugly, as you describe). > > I don't know if there is any way to get exactly what you had > before, but in 1.6 I suggest trying this: use single-layer > transparency (which is the default), make only the surface > transparent, keep the ribbon opaque. If you want the ribbon > to be less bold, try making it a pastel color. > > I am not involved in the graphics programming -- I CC'd the > list since the other developers may have suggestions (and > other users might find the discussion informative). > I hope this helps, > Elaine > ---------- > Elaine C. Meng, Ph.D. > UCSF Computer Graphics Lab (Chimera team) and Babbitt Lab > Department of Pharmaceutical Chemistry > University of California, San Francisco > >

1 1

Surface atoms and charges
by Nikolay Igorovich Rodionov 14 May '12

14 May '12

Hi all, I was wondering if any of you knew of a way to determine exactly what atoms occur on the surface of a molecule or how to get the exact charge at a point on a surface. Thank you, Nikolay Rodionov

2 1

AMBER ff99SB Documentation
by Nikolay Igorovich Rodionov 12 May '12

12 May '12

Hi all, Could someone point in the direction of some good documentation on ff99SB, how it functions, and what calculations it performs? Thank you, Nikolay Rodionov

2 1

Using Chimera from non-chimera python scripts
by Dan Cohen 11 May '12

11 May '12

Hello, I would like to use Chimera python classes from a python script running outside Chimera (part of a larger python project). I saw another post that explained that this could be done but I was unclear which of the Chimera functionality can be used in this case. In case I want to create an image (e.g. load pdb files, do some editing and then create an image to a file) - can I use the "chimera" class or do I need to use something else? (I saw a reference to "midas" classes) Is there an example for doing that? Processing a file and creating an image in a non-GUI scenario running outside chimera? Thank you, Dany

3 3

Re: [Chimera-users] semi-transparent ribbon behind semi-transparent surface
by Elaine Meng 11 May '12

11 May '12

On May 3, 2012, at 8:05 AM, Sumitro Harjanto wrote: > Hi Elaine, > I used to use CHIMERA 1.5 to generate some molecular images. and I was able to show a "hint of shadow" of ribbon behind a semitransparent molecular surface. but I realised that I can no longer do that from Chimera 1.6 onwards. I have tried fiddling with the new "single layer transparency" value, but either option did not provide me with the visual effect that I could previously get in chimera 1.5. when I turned off the single layer transparency, the molecular surface became very messy with multiple shades and the color is visibly darker. but If I leave it on, the semi-transparent ribbon was not displayed at all. is there anyway that I can achieve a similar effect in Chimera 1.6? i.e if you're wondering what effect I am talking about here is an example: http://onlinelibrary.wiley.com/store/10.1002/emmm.201200213/asset/image_n/n… > Thanks, Elaine! > Cheers, > Sumitro Hi Sumitro! In Chimera 1.5 each surface could have its own single-layer transparency. Thus you could still have multiple transparent layers overall, but only the top layer of each surface. I'm guessing the image is something like that (I don't have permission to view it). In Chimera 1.6 the choices are only either a single layer of transparency, or all transparent layers. In Chimera 1.5 if you turn off single-layer transparency for each surface, the result is the same as in Chimera 1.6 if you turn off global single-layer transparency. However, I realize that does not help, since you don't want to show all layers (it's often ugly, as you describe). I don't know if there is any way to get exactly what you had before, but in 1.6 I suggest trying this: use single-layer transparency (which is the default), make only the surface transparent, keep the ribbon opaque. If you want the ribbon to be less bold, try making it a pastel color. I am not involved in the graphics programming -- I CC'd the list since the other developers may have suggestions (and other users might find the discussion informative). I hope this helps, Elaine ---------- Elaine C. Meng, Ph.D. UCSF Computer Graphics Lab (Chimera team) and Babbitt Lab Department of Pharmaceutical Chemistry University of California, San Francisco

3 3

Partial Charge and Electrostatic Potential Maps
by Nikolay Igorovich Rodionov 10 May '12

10 May '12

Hi Everyone, I was wondering if there is a way to create a maps of partial charge and electrostatic potential that I could then overlay on top of a similar structure. The biological assembly I am working with is too large for good surface calculations so I would like to overlay these maps on the surface of a condensed structure that only includes the regions I am concentrating on. Thank you, Nikolay Rodionov

3 2

Recording actions
by Nikolay Igorovich Rodionov 10 May '12

10 May '12

Hi all, Is there any way to get a read out of all of the operations I have performed within a session? I know of the command history option but that only record the commands I have entered in the command line. I would like to be able to record my command line and non-command line actions, in the order they occurred. Thank you, Nikolay Rodionov

2 2