- Chimera-users - RBVI Mailing Lists

Nutate or lemniscate program to scenes/animation?
by Hurt, Darrell (NIH/NIAID) [E] 19 Nov '12

19 Nov '12

Hi Chimera folks! I love, love, love the new scene-based animation! I know that it is still under development, but it is fantastic! And the "Animation" utility panel is easy to use and understand. I love the "Rock" and "Roll" "Actions" available in the Animation panel. That goes a long way to making movie-making a point-and-click affair! I would like to suggest or propose one more "Action" in addition to "Rock" and "Roll". It is "nutate" or "lemniscate". It is basically a "rock" in both the X and Y planes at the same time. I think that it can be coded relatively simply with a cosine function about the X axis concomitant to the sine function about the Y axis that is driving the current "Rock". You can see an example of what I'm talking about here: http://youtu.be/55_cmJLe3Is Also, if I could, I would also suggest or propose that the "Rock" and "Nutate/Lemniscate" have a single parameter to control the "width" of the rock or nutation/lemniscation — maybe choices of 15, 30, 45, and 60 degrees or a free-form entry. Thanks for everything you do! Best wishes, Darrell Darrell Hurt, Ph.D. Section Head, Computational Biology Bioinformatics and Computational Biosciences Branch (BCBB) OCICB/OSMO/OD/NIAID/NIH 31 Center Drive, Room 3B62B, MSC 2135 Bethesda, MD 20892-2135 Office 301-402-0095 Mobile 301-758-3559 http://bioinformatics.niaid.nih.gov (Within NIH) http://exon.niaid.nih.gov (Public) Disclaimer: The information in this e-mail and any of its attachments is confidential and may contain sensitive information. It should not be used by anyone who is not the original intended recipient. If you have received this e-mail in error please inform the sender and delete it from your mailbox or any other storage devices. National Institute of Allergy and Infectious Diseases shall not accept liability for any statements made that are sender's own and not expressly made on behalf of the NIAID by one of its representatives.

3 3

Re: [Chimera-users] Using marker files to place oriented density maps inside a tomogram
by Tom Goddard 16 Nov '12

16 Nov '12

Hi Daniel, Probably you can modify your script and make Chimera open the copies much faster. The python script should also achieve that. The trick with your command script is that between each command Chimera draws a frame and may update the volume dialog histograms. One way to avoid this is put all the commands on one line separated by semicolons. Maybe another better method is have one open command and one transform setting command open template.em template.em template.em ... (repeat for as many copies as you need) matrixset transforms.txt I believe the matrixset command can have the positions for as many models as you want with the model id number specified before the transform. See the Chimera manual or try matrixget to write an example file with several models being displayed to see the precise format when you have multiple transforms. A Python script could be faster still because it wouldn't need to open the same map file over and over. It could create all the map copies from the first. As an example making 100 translated copies of an open 100**3 volume took 3 seconds with the following Python from VolumeViewer import active_volume v = active_volume() from chimera import Xform for i in range(100): c = v.copy() c.openState.localXform(Xform.translation(i*20,0,0)) c.show() Tom > Hi Tom, > > > Yes, both methods that you describe work nicely. In particular, I was > not aware of the possibility of changing the level of a set of models > with a single command line operation: that does help a lot. > > The only actual annoyance that remains in my implementation for the > manipulation of sets of volumes is the loading of the volumes?. I > suspect the way I do it is too rudimentary, as I just open Chimera > passing as argument a .cmd command file that loads the same file again > and again, placing it each time in a different location, i.e: > > open 0 template.em > matrixset transform_0.cmd > open 1 template.em > matrixset transform_1.cmd > > ? and so on for hundreds of models, so that the user basically sees > the Volume Viewer getting updated with a new model and then a new one > for several minutes. I guess with the .py script that you send me I > will be able to load the volumes in a less messy manner than this one. > > Thanks for all the info! > Daniel > > >> Hi Daniel, >> >> I see. You'd like to control the contour level, color, >> surface/mesh style, step size... of all the copies as if they were >> one model instead of 100 different models, each a copy of the same >> map. For making hundreds of copies of an atomic model, the >> multiscale dialog in Chimera does this using a single model. But >> that doesn't currently work with maps. One disadvantage of having a >> single model for all the copies of a map is that the maps will all >> have to have the same color, same step size, same contour level >> because all those properties are stored with the model. Maybe that >> restriction is fine for your use. I would like to make that possible >> by allowing Chimera to place identical copies of any type of model by >> just specifying the list of positioning matrices. The model would >> just remember the list of matrices for the different placements. >> >> For now using a hundred different models of the same map is >> workable. You can't adjust all of them at the same time with the >> volume dialog. But you can adjust one to figure out the contour >> level you like and then use one volume command to set the level for >> all the copies, for example, "volume #1-100 level 1.24 color yellow >> step 2". >> >> Another approach is to make a single map by adding your hundred >> placed copies on a single grid (e.g. the tomogram grid). Then you >> open that one map and all the copies appear. The drawback is that you >> may want finer grid spacing on the individual copies then you have >> with the tomogram, and that would make the map to large and slow to >> work with (and mostly empty). If you are interested in trying this >> approach though you can use a command like "vop add #1-100 onGrid #0" >> to produce such a map after placing the hundred separate models with >> your current script. Then save that new map and use it in the future >> instead of the 100 copies. >> >> Tom >> >> >> -------- Original Message -------- >> Subject: Re: [Chimera-users] Using marker files to place oriented >> density maps inside a tomogram >> From: Daniel Castano Diez >> To: Tom Goddard >> Date: 11/15/12 7:12 AM >>> Hi Tom, >>> >>> thanks for the helpful explanation. The extension that you mention >>> you've been working on seems interesting. I guess that will allow >>> the user to change the isosurface level in one single model to >>> change it in all the models simultaneously, am I right? This would >>> solve another problem I'm having with my scripts, as they fed each >>> copy of the map into Chimera as a different model. So, I'm looking >>> forwards to trying it when it becomes available. >>> >>> best, >>> Daniel >>> >>> >>> >>>> Hi Daniel, >>>> >>>> You can use a Chimera marker file but that only knows how to place >>>> spheres. If you wanted to make use of the "map" and "matrix" >>>> attributes you added to the markers then that would require some >>>> extra Python script. That could be done -- it is just a different >>>> format of input from the script I sent you. >>>> >>>> If you can't display hundreds of copies of the map due to slow >>>> graphics then it doesn't matter how you input the data. Having >>>> hundreds of copies of the same map open doesn't load the map data >>>> more than once. So you shouldn't run out of memory. But the >>>> surface for each map might have a million triangles and it does >>>> make a separate surface copy for each copy you place in your >>>> tomogram. Of course you won't see the detail in a tiny map put >>>> into a tomogram so the solution would be to display a very coarse >>>> image of the map that is being placed many times in the tomogram. >>>> I've worked recently on making Chimera display multiple copies of >>>> identical objects without making copies of the surface in memory -- >>>> just reuse the same surface. But it is not in Chimera yet. And >>>> your graphics speed will still become unusable if you try to >>>> display too many copies with too much detail. So the main need is >>>> to show an appropriate low level of detail for all or most of your >>>> hundreds of copies. >>>> >>>> Tom >>>> >>>> >>>> -------- Original Message -------- >>>> Subject: Re: [Chimera-users] Using marker files to place oriented >>>> density maps inside a tomogram >>>> From: Daniel Castano Diez >>>> To: Tom Goddard >>>> Date: 11/14/12 1:28 PM >>>>> Hi Tom, >>>>> >>>>> thanks for the answer. Actually I already wrote some scripts for >>>>> placing each different copy of the density map as an individual >>>>> model, but this is not practical for placing hundreds of copies >>>>> (as it's the case with tomograms). I will try your python script. >>>>> >>>>> >>>>> I was under the impression that a .cmm markerfile was a better >>>>> approach, as I though that one could define a marker with more >>>>> attributes as in the example: >>>>> >>>>> <marker id="1" x="-6.1267" y="17.44" z="-3.1338" radius="0.35217"/> >>>>> >>>>> I mean, something like: >>>>> >>>>> <marker id="1" x="-6.1267" y="17.44" z="-3.1338" map >>>>> ="my_map.em" matrix = "my_matrix.txt" /> >>>>> >>>>> or similar with quaternions or euler angles... but I guess that >>>>> was wrong? That'll be a pitty, as I am interfacing Chimera with >>>>> the subtomogram averaging package Dynamo and the most stable way >>>>> seemes to be having Dynamo converting its "table" files (lists of >>>>> positions and angles) into .cmm files that could then be directly >>>>> fed into Chimera. >>>>> >>>>> Thanks! >>>>> >>>>> Daniel >>>>> >>>>> >>>>> >>>>> >>>>>> Hi Daniel, >>>>>> >>>>>> Take a look at the placem.py script which can place copies of >>>>>> maps or molecules at specified positions. >>>>>> >>>>>> http://plato.cgl.ucsf.edu/trac/chimera/wiki/Scripts >>>>>> >>>>>> It specifies the rotation as a quaternion which is close to a >>>>>> rotation axis and angle description. I could show you how to >>>>>> adapt it to use Euler angles or a 3x3 rotation matrix if you like. >>>>>> >>>>>> Tom >>>>>> >>>>>> >>>>>> >>>>>>> Hi, >>>>>>> >>>>>>> I'd like to use a Chimera marker file to place multiple copies >>>>>>> of a density map in different spatial positions inside a >>>>>>> tomogram. My input is thus a single map file a set of 3d >>>>>>> locations, each attached to an euler triplet (or a rotation matrix) >>>>>>> >>>>>>> With the documentation I could find >>>>>>> >>>>>>> http://www.cgl.ucsf.edu/chimera/1.2065/docs/ContributedSoftware/volumepatht… >>>>>>> it is explained how to place spheres without orientation in a >>>>>>> volume, but I was not able to figure out how to place a density >>>>>>> map at those locations, and also how to impart a different >>>>>>> orientation to the density map located at each position. >>>>>>> >>>>>>> My question is: where could I find a description of the marker >>>>>>> file syntax that describes this functionality? >>>>>>> >>>>>>> thanks, >>>>>>> Daniel >>>>>>> >>>>>>> >>>>>>> ---------------------------------------------------------------- >>>>>>> This message was sent using IMP, the Internet Messaging Program. >>>>>>> >>>>>>> >>>>>>> _______________________________________________ >>>>>>> Chimera-users mailing list >>>>>>> Chimera-users(a)cgl.ucsf.edu >>>>>>> http://plato.cgl.ucsf.edu/mailman/listinfo/chimera-users >>>>>>> >>>>>> >>>>>> >>>>> >>>>> >>>>> >>>>> ---------------------------------------------------------------- >>>>> This message was sent using IMP, the Internet Messaging Program. >>>>> >>>>> >>>> >>>> >>> >>> >>> >>> ---------------------------------------------------------------- >>> This message was sent using IMP, the Internet Messaging Program. >>> >>> >> >> > > > > ---------------------------------------------------------------- > This message was sent using IMP, the Internet Messaging Program. > >

2 1

delay updating to Ubuntu 12.10
by Greg Couch 15 Nov '12

15 Nov '12

Something happened in Ubuntu 12.10 that breaks Chimera's SideView tool, even if you have the proprietary graphics driver installed. So we recommend waiting until this bug is resolved. I plan to retest Ubuntu 12.10 every two or three weeks, but if anyone finds out that it is fixed earlier, please let me know. HTH, Greg

1 0

Re: [Chimera-users] Using marker files to place oriented density maps inside a tomogram
by Tom Goddard 15 Nov '12

15 Nov '12

Hi Daniel, I see. You'd like to control the contour level, color, surface/mesh style, step size... of all the copies as if they were one model instead of 100 different models, each a copy of the same map. For making hundreds of copies of an atomic model, the multiscale dialog in Chimera does this using a single model. But that doesn't currently work with maps. One disadvantage of having a single model for all the copies of a map is that the maps will all have to have the same color, same step size, same contour level because all those properties are stored with the model. Maybe that restriction is fine for your use. I would like to make that possible by allowing Chimera to place identical copies of any type of model by just specifying the list of positioning matrices. The model would just remember the list of matrices for the different placements. For now using a hundred different models of the same map is workable. You can't adjust all of them at the same time with the volume dialog. But you can adjust one to figure out the contour level you like and then use one volume command to set the level for all the copies, for example, "volume #1-100 level 1.24 color yellow step 2". Another approach is to make a single map by adding your hundred placed copies on a single grid (e.g. the tomogram grid). Then you open that one map and all the copies appear. The drawback is that you may want finer grid spacing on the individual copies then you have with the tomogram, and that would make the map to large and slow to work with (and mostly empty). If you are interested in trying this approach though you can use a command like "vop add #1-100 onGrid #0" to produce such a map after placing the hundred separate models with your current script. Then save that new map and use it in the future instead of the 100 copies. Tom -------- Original Message -------- Subject: Re: [Chimera-users] Using marker files to place oriented density maps inside a tomogram From: Daniel Castano Diez To: Tom Goddard Date: 11/15/12 7:12 AM > Hi Tom, > > thanks for the helpful explanation. The extension that you mention > you've been working on seems interesting. I guess that will allow the > user to change the isosurface level in one single model to change it > in all the models simultaneously, am I right? This would solve another > problem I'm having with my scripts, as they fed each copy of the map > into Chimera as a different model. So, I'm looking forwards to trying > it when it becomes available. > > best, > Daniel > > > >> Hi Daniel, >> >> You can use a Chimera marker file but that only knows how to place >> spheres. If you wanted to make use of the "map" and "matrix" >> attributes you added to the markers then that would require some >> extra Python script. That could be done -- it is just a different >> format of input from the script I sent you. >> >> If you can't display hundreds of copies of the map due to slow >> graphics then it doesn't matter how you input the data. Having >> hundreds of copies of the same map open doesn't load the map data >> more than once. So you shouldn't run out of memory. But the surface >> for each map might have a million triangles and it does make a >> separate surface copy for each copy you place in your tomogram. Of >> course you won't see the detail in a tiny map put into a tomogram so >> the solution would be to display a very coarse image of the map that >> is being placed many times in the tomogram. I've worked recently on >> making Chimera display multiple copies of identical objects without >> making copies of the surface in memory -- just reuse the same >> surface. But it is not in Chimera yet. And your graphics speed will >> still become unusable if you try to display too many copies with too >> much detail. So the main need is to show an appropriate low level of >> detail for all or most of your hundreds of copies. >> >> Tom >> >> >> -------- Original Message -------- >> Subject: Re: [Chimera-users] Using marker files to place oriented >> density maps inside a tomogram >> From: Daniel Castano Diez >> To: Tom Goddard >> Date: 11/14/12 1:28 PM >>> Hi Tom, >>> >>> thanks for the answer. Actually I already wrote some scripts for >>> placing each different copy of the density map as an individual >>> model, but this is not practical for placing hundreds of copies (as >>> it's the case with tomograms). I will try your python script. >>> >>> >>> I was under the impression that a .cmm markerfile was a better >>> approach, as I though that one could define a marker with more >>> attributes as in the example: >>> >>> <marker id="1" x="-6.1267" y="17.44" z="-3.1338" radius="0.35217"/> >>> >>> I mean, something like: >>> >>> <marker id="1" x="-6.1267" y="17.44" z="-3.1338" map ="my_map.em" >>> matrix = "my_matrix.txt" /> >>> >>> or similar with quaternions or euler angles... but I guess that was >>> wrong? That'll be a pitty, as I am interfacing Chimera with the >>> subtomogram averaging package Dynamo and the most stable way seemes >>> to be having Dynamo converting its "table" files (lists of positions >>> and angles) into .cmm files that could then be directly fed into >>> Chimera. >>> >>> Thanks! >>> >>> Daniel >>> >>> >>> >>> >>>> Hi Daniel, >>>> >>>> Take a look at the placem.py script which can place copies of maps >>>> or molecules at specified positions. >>>> >>>> http://plato.cgl.ucsf.edu/trac/chimera/wiki/Scripts >>>> >>>> It specifies the rotation as a quaternion which is close to a >>>> rotation axis and angle description. I could show you how to adapt >>>> it to use Euler angles or a 3x3 rotation matrix if you like. >>>> >>>> Tom >>>> >>>> >>>> >>>>> Hi, >>>>> >>>>> I'd like to use a Chimera marker file to place multiple copies of >>>>> a density map in different spatial positions inside a tomogram. My >>>>> input is thus a single map file a set of 3d locations, each >>>>> attached to an euler triplet (or a rotation matrix) >>>>> >>>>> With the documentation I could find >>>>> >>>>> http://www.cgl.ucsf.edu/chimera/1.2065/docs/ContributedSoftware/volumepatht… >>>>> it is explained how to place spheres without orientation in a >>>>> volume, but I was not able to figure out how to place a density >>>>> map at those locations, and also how to impart a different >>>>> orientation to the density map located at each position. >>>>> >>>>> My question is: where could I find a description of the marker >>>>> file syntax that describes this functionality? >>>>> >>>>> thanks, >>>>> Daniel >>>>> >>>>> >>>>> ---------------------------------------------------------------- >>>>> This message was sent using IMP, the Internet Messaging Program. >>>>> >>>>> >>>>> _______________________________________________ >>>>> Chimera-users mailing list >>>>> Chimera-users(a)cgl.ucsf.edu >>>>> http://plato.cgl.ucsf.edu/mailman/listinfo/chimera-users >>>>> >>>> >>>> >>> >>> >>> >>> ---------------------------------------------------------------- >>> This message was sent using IMP, the Internet Messaging Program. >>> >>> >> >> > > > > ---------------------------------------------------------------- > This message was sent using IMP, the Internet Messaging Program. > >

1 0

Using marker files to place oriented density maps inside a tomogram
by Daniel Castano Diez 14 Nov '12

14 Nov '12

Hi, I'd like to use a Chimera marker file to place multiple copies of a density map in different spatial positions inside a tomogram. My input is thus a single map file a set of 3d locations, each attached to an euler triplet (or a rotation matrix) With the documentation I could find http://www.cgl.ucsf.edu/chimera/1.2065/docs/ContributedSoftware/volumepatht… it is explained how to place spheres without orientation in a volume, but I was not able to figure out how to place a density map at those locations, and also how to impart a different orientation to the density map located at each position. My question is: where could I find a description of the marker file syntax that describes this functionality? thanks, Daniel ---------------------------------------------------------------- This message was sent using IMP, the Internet Messaging Program.

2 3

Re: [Chimera-users] Fussy density around the particle
by Elaine Meng 14 Nov '12

14 Nov '12

On Nov 14, 2012, at 4:04 AM, Mohit Kumar wrote: > Hi Elaine, > Can you please tell me how to remove the fussy density from the plane of a > particle? > I went to Volume Viewer>Features>Planes>One to make a plane of the particle. > I can see a fussy density around the particle at the entire boundary. > How can I deactivate it ?? > Thanks in advance. > Best, > Mohit > Hi Mohit, Please send chimera questions to chimera-users(a)cgl.ucsf.edu rather than to me directly -- it allows other people to answer if I cannot, and allows other users to benefit from the information. In this case, I may not understand the question. You could (a) adjust the thresholds for density display using the Volume Viewer dialog <http://www.cgl.ucsf.edu/chimera/docs/ContributedSoftware/volumeviewer/frame…> <http://www.cgl.ucsf.edu/chimera/docs/ContributedSoftware/volumeviewer/volum…> (b) filter your map using Volume Filter (in menu under Tools... Volume Data) <http://www.cgl.ucsf.edu/chimera/docs/ContributedSoftware/volumeviewer/gauss…> (c) erase parts of a map using Volume Eraser (d) segment using Segment Map etc... see "volume tour" <http://www.cgl.ucsf.edu/chimera/data/tutorials/volumetour/volumetour.html> Best, Elaine

1 0

lib64bz2, question, running and installing chimera
by Sai Tong 14 Nov '12

14 Nov '12

I tried to install alpha version of chimera today in a linux machine running fedora core 14 chimera-alpha-linux_x86_64.bin after installation, running chimera gives the following Traceback (most recent call last): File "/opt/UCSF/Chimera64-2012-11-14/share/__main__.py", line 69, in <module> value = chimeraInit.init(sys.argv) File "/opt/UCSF/Chimera64-2012-11-14/share/chimeraInit.py", line 594, in init import chimera File "/opt/UCSF/Chimera64-2012-11-14/share/chimera/__init__.py", line 16, in <module> from _chimera import BBox, Camera, Color, ColorGroup, DirectionalLight, LODControl, Lens, LensViewer, Light, Material, MaterialColor, Model, NoGuiViewer, OGLFont, OSLAbbreviation, OpenModels, OpenState, PathFinder, PixelMap, Plane, Point, PositionalLight, Selectable, SharedState, SpotLight, Sphere, Texture, TextureColor, TrackChanges, Vector, Viewer, X3DScene, Xform ImportError: libbz2.so.1.0: cannot open shared object file: No such file or directory The lib64 directory contains the following: lrwxrwxrwx. /lib64/libbz2.so.1 -> libbz2.so.1.0.6 -rwxr-xr-x. /lib64/libbz2.so.1.0.6 If I install the current production release version, running chimera from this production installation would be without problem. Should I temporarily link libbz2.so.1.0.6 to libbz2.so.1.0 in /lib64 in order to make the alpha version of chimera run?

2 1

Re: [Chimera-users] occupancy calculations
by Benjamin SCHWARZ 12 Nov '12

12 Nov '12

Hi Tom, Not sure I understand you well, my problem doesn't seem to be merely connected with threshold settings. Please have a look at the attached screenshot. I generated the red map with the occupancy tool, values range from 0 to 213. Then I saved it, changed the name, reopened it, and got that yellowish map with values from -128 to 127. It looks like a certain range of values was somehow shifted somewhere in the process… --Ben Le 10 nov. 2012 à 19:46, Tom Goddard a écrit : > Hi Ben, > > You have to set the contour level for the surface after you open the occupancy map. This is set with the volume dialog by moving the bar on the histogram or using the level entry field, or you can use the volume command (volume #0 level 0.123). The displayed level when you first created the map was apparently much lower than the level that is automatically chosen when you open the saved map file. > > Tom > > > On Nov 9, 2012, at 10:24 PM, Eric Pettersen <pett(a)cgl.ucsf.edu> wrote: > >> Hi Ben, >> The save and restore of the volume map isn't the part of Chimera I work on. I'm forwarding your message to Tom Goddard, who programs the vast majority of Chimera's volumetric capabilities, and hopefully he'll get back to you with a solution soon. >> >> --Eric >> >> Begin forwarded message: >> >>> From: Benjamin SCHWARZ <schwarz.ben(a)gmail.com> >>> Date: November 9, 2012 8:29:56 AM PST >>> To: Eric Pettersen <pett(a)cgl.ucsf.edu> >>> Subject: Re: [Chimera-users] occupancy calculations >>> >>> Hi Eric, >>> >>> Creation of the map works fine, but I have issues opening it when saved. You'll find attached a picture of the map as it is computed and rendered on my screen (good), ad of what happen to it when I save it and reload it from the file. Hopes this helps. >>> >>> <image--bug-visu---good.png> >>> >>> <image--bug-visu---bad.png> >>> >>> >>>> Hi Ben, >>>> I just added an option to MD Movie to allow atomic radii to be factored in. The two options (other than the previous behavior which is also available) is to increment all grid cells within the atomic radii uniformly, or to increment those closer to the atomic center more. The latter is a very simple scheme in that the "outermost" cells are incremented by 1, the next layer by 2, the next by 3, etc. with the center cell getting the highest increment. >>>> >>>> --Eric >>> >> --- Benjamin SCHWARZ Email : schwarz(a)igbmc.fr Voice : +33 (0)3 68 85 47 30 FAX : +33 (0)3 68 85 47 18 Biocomputing group -- Integrated Structural Biology -- IGBMC 1 rue Laurent Fries, BP 10142 F - 67404 Illkirch CEDEX FRANCE

2 1

save axes coordinates?
by esserlo＠helix.nih.gov 09 Nov '12

09 Nov '12

Hi, I'd like to write out the coordinates of helix axes and I know that this can be done in "Structure Measurements" gui window with "Save". However, I would like to be able to use a script. So how can I activate this "Save" function from a script (.com) ? Ah, there is one more thing, when I calculate the angle beween 2 helix axes the result is printed in the "Reply log" - useful but can I also automatically write this on out to keep a record? Thanks, Lothar P.S. I am currently using chimera-1.7-alpha 11/9/12 on 64 bit Linux.

2 1

icosahedral reconstruction volume color
by Reginald McNulty 08 Nov '12

08 Nov '12

Dear Users, I've done a symmetric reconstruction utilizing Viper (I1) icosahedral symmetry with XMIPP. Is there a way to color my recon.vol file surface according to symmetry? Kind regards, Reggie -- Reginald McNulty, Ph.D. Postdoctoral Research Associate The Scripps Research Institute Johnson Lab Department of Molecular Biology La Jolla, California 92037 Email: rmcnulty(a)scripps.edu

4 9

Re: [Chimera-users] Ubuntu 12.04 and Chimera 1.6.2
by Greg Couch 06 Nov '12

06 Nov '12

There are lots of things that could be wrong. To confirm that the X11/OpenGL GLX extension is missing, run the glxinfo program from the mesa-utils package (if you need to install mesa-utils, installing the associated dependencies might solve your problem) -- it should fail. Next examine /var/log/Xorg.0.log to see the error the X11 server has loading the GLX extension. Fix that error, restart the X11 server, and repeat until the glxinfo program works. Then Chimera should work too. Last bit of advice, a simple thing to try is to (re)install the graphics driver. If you have AMD/ATI or NVIDIA graphics, we strongly recommend that you install the proprietary driver that is installed with the Additional Drivers tool in the System Settings dialog. If you have Intel graphics and glxinfo works, but Chimera doesn't, then make sure you have all the Ubuntu patches installed. But even if you keep your system up-to-date, if you have Intel graphics, you should switch to newer versions of Ubuntu when they come out -- for instance, today, you should upgrade to 12.10, and I'd recommend 13.04 when it comes out, /ad infinitum/ or at least for the next 5 years, until the Intel graphics driver is much less buggy (it has drastically improved in the last couple of years, but there is much more being done). HTH, Greg On 11/06/2012 12:26 PM, sette(a)uniroma2.it wrote: > > Dear all, > > in Ubuntu 12.04, 32 bit, I have the following error message when > starting Chimera 1.6.2: > > "Error initializing OpenGL: X server is missing OpenGL GLX extension. > Couldn't configure togl widget". > > Do you know a solution for this problem? > > Thanks, > Marco > > > Dr.Marco Sette, Ph.D. > > Department of Chemical Sciences and Technology > University of Rome, "Tor Vergata" > via della Ricerca Scientifica, 00133, Rome, Italy > e-mail: sette(a)uniroma2.it > e-mail: m77it(a)yahoo.it > Tel.: +39-0672594424 > Fax: +39-0672594328 > > www.rete29aprile.it > > > ---------------------------------------------------------------- > Invito da parte dell'Ateneo: > Il tuo futuro e quello della Ricerca Scientifica hanno bisogno del > tuo aiuto. Dona il 5 x mille all'Universita' di Roma Tor Vergata > codice fiscale: 80213750583 http://5x1000.uniroma2.it

1 0

Re: [Chimera-users] Problem with RMSD calculation
by Eric Pettersen 06 Nov '12

06 Nov '12

On Nov 2, 2012, at 1:33 AM, Aditi Gangopadhyay wrote: > Dear Sir/Madam, > > I've been using Chimera for the calculation of RMSD of two ligands associated with a protein. (In my specific case, it is the same ligand, one being associated with the usual protein, and the other with the protein bound to a small molecule). However, I have had a problem with this, since the RMSD values are differing when I select my concerned ligand using GUI and when I select using the ctrl+drag way. I would be very grateful if you would kindly tell me where I'm going wrong in my selection or somewhere else. Thank you so much in advance for your help! > > Regards, > Aditi. > -- > Aditi Gangopadhyay > > Junior Research Fellow > DBT Centre for Bioinformatics > Presidency University > Kolkata, India Hi Adit, I'm assuming you are using the "match" or "rmsd" command to measure the RMSD. The problem with using a selection as an argument to the command is that the atoms are matched in the same order as they were selected. This is fine if you selected the atoms one by one (with shift-control-click), but a control-drag adds the atoms to the selection in an arbitrary order. Probably the easiest way to specify your ligand in the match command, assuming there is only one instance of the ligand in each model and the models are #0 and #1 (and the ligand name is, say, "XYZ"): rmsd #0:xyz #1:xyz --Eric Eric Pettersen UCSF Computer Graphics Lab http://www.cgl.ucsf.edu

3 2

MD analysis : get clusters
by Benjamin SCHWARZ 05 Nov '12

05 Nov '12

Hi list, I clustered a bunch of structures using the MD clustering tool, I am very happy with the result but I can't find how to download/save the result. Is there a way for instance to copy-paste the columns indicating the number of models as well as the index of the representative for each cluster; alternatively, is possible to sort out frames by clusters ? If there are command shortcuts to manipulate the clustering, I'd be happy to get them, or to get a link to it in the manual. Chimera is really a great tool, but the learning curve appears really steep ;) Ultimately, I wonder about the type of clustering used here. I suspect a complete linkage but I couldn't find the confirmation in the manual. Any info on that ? Thanks a lot for your extremely good work, and the fast answers on this mailing list --Ben

4 4

occupancy calculations
by Benjamin SCHWARZ 02 Nov '12

02 Nov '12

Hi list, I am using the MD->occupancy tool to produce occupancy densities of a very coarse grained model (I have a few spheres, with big radii : approximatively 10 spheres with 10A radius each). My problem is that the density is computed only for the center of each sphere, which tells me where the center stands. To have a better feeling of the space occupied by each sphere I'd rather like a density computed for the whole sphere (updating each cell of the grid by either incrementing if the cell is covered by the sphere, or why not with any type of kernel centered on the sphere and depending on the sphere's radius.). Can I do that with Chimera ? And if so, How ? thanks --Ben

4 4

Re: [Chimera-users] Regarding Hydrogen Bond
by Elaine Meng 01 Nov '12

01 Nov '12

Dear Amit, You can identify hydrogen bonds with FindHBond (in menu under Tools... Structure Analysis). Click the Help button on that tool or see here for instructions: <http://www.cgl.ucsf.edu/chimera/docs/ContributedSoftware/findhbond/findhbon…> If you want to analyze the environment around the metal and then add metal coordination bonds, you could use Metal Geometry (in menu under Tools... Structure Analysis): <http://www.cgl.ucsf.edu/chimera/docs/ContributedSoftware/metalgeom/metalgeo…> If you don't care about analysis and just want to draw a line between two atoms, you could do that using either of the following: (A) distance measurements, for example using the Distances tool (change label to "none" if you don't want to see the distance value) <http://www.cgl.ucsf.edu/chimera/docs/ContributedSoftware/structuremeas/stru…> (B) PseudoBond Reader <http://www.cgl.ucsf.edu/chimera/docs/ContributedSoftware/pbreader/pbreader.…> Please send Chimera questions to the chimera-users(a)cgl.ucsf.edu address so that everybody can benefit. You can search the manual using Help... Search Documentation in the Chimera menu, and you can search the chimera-users messages here: <http://www.cgl.ucsf.edu/chimera/docs/feedback.html> I hope this helps, Elaine ----- Elaine C. Meng, Ph.D. UCSF Computer Graphics Lab (Chimera team) and Babbitt Lab Department of Pharmaceutical Chemistry University of California, San Francisco On Oct 24, 2012, at 8:54 AM, Amit Jaiswal wrote: > Dear Dr.Meng, > Many thanks for your mail and suggestion for Metal fixation. I have done what you have advised. So, now my metal is near the catalytic site. So the next step is to form bond between Mg and Aspartic Acid residues. Now, I am confused. So I want to ask weather hydrogen bond and co-ordinate bond can be formed in Chimera? > Please do let me know. >

2 3

aligning multiple models in the same session
by m.sani＠nki.nl 30 Oct '12

30 Oct '12

Hi, I have 4 EM maps opened in one session and cant seem to get them all to align to a central map as origin. I have tried to fit them by hand onto one another and then move it translationally with “move” command to translates a specified model by a distance along a specified axis; in addition to a translational shift, the models also seems to be slightly rotated with respect to one another (see attach image). Can you help please? Musa Sani, PhD --------------------------------------------- Cell Biology II(B6) The Netherlands Cancer Institute-Antoni van Leeuwenhoek Hospital Plesmanlaan 121, 1066CX Amsterdam, the Netherlands, mobile: +31 625 498 194 Tel: +31 20 512 1008

2 1

Amber-style mol2 name
by Nikolay Igorovich Rodionov 26 Oct '12

26 Oct '12

Hi all, Simple Questions: To create mol2 files with naming compatible with Ambersuite programs I would have to save with non-sybyl hydrogen naming, yes? Also, after I save the files with the amber style naming scheme, which atom name column has the AMBER style naming (there are two)? Thanks! Nikolay Rodionov| MBA Candidate & B.S. Bioengineering 2015 Martin J. Whitman School of Management & L.C. Smith College of Engineering at Syracuse University Syracuse, New York 13244 Phone: 281.301.9401| Email: Nirodion(a)syr.edu

2 6

how to mask irregular shape in EM density map
by sy31802 25 Oct '12

25 Oct '12

Dear all, We want to color our EM density map , so we need mask different part of the map in order to distinguish them with different colors. Unfortunately, the sample is not irregular shape , we could not use "shape" to mask volume as usually. Could anyone give some suggestion? We also use Amira for 3D rendering. We think the rendering in amira is just the mask, so we want solve the problem the mask the irregular shape with amira , have anyone done with it? best regard 2012-10-25 sy31802

2 1

Re: [Chimera-users] segmentation fault
by Tim Richardson 25 Oct '12

25 Oct '12

Hi, I'm getting segmentation faults when using chimera. I tried to produce a backtrace, but got an error: [tim@nest ~]$ gdb chimera core.3777 GNU gdb (GDB) Fedora (7.4.50.20120120-50.fc17) Copyright (C) 2012 Free Software Foundation, Inc. License GPLv3+: GNU GPL version 3 or later <http://gnu.org/licenses/gpl.html > This is free software: you are free to change and redistribute it. There is NO WARRANTY, to the extent permitted by law. Type "show copying" and "show warranty" for details. This GDB was configured as "i686-redhat-linux-gnu". For bug reporting instructions, please see: <http://www.gnu.org/software/gdb/bugs/>... "/usr/bin/chimera": not in executable format: File format not recognized [New LWP 3777] [New LWP 3787] Core was generated by `/opt/UCSF/Chimera-1.6.2/bin/python2.7 /opt/UCSF/Chimera-1.6.2/share/__main__.py'. Program terminated with signal 11, Segmentation fault. #0 0xb578ddc7 in ?? () (gdb) bt #0 0xb578ddc7 in ?? () #1 0x0963be90 in ?? () Backtrace stopped: previous frame inner to this frame (corrupt stack?) Could you advise how I might avoid a segmentation fault and what I'm doing wrong with the backtrace. Is there anything I can do short of installing a VM and running the windows version? Many thanks, Tim Richardson @timrich

2 1

Regarding Metal Fixing in Protein
by Amit Jaiswal 24 Oct '12

24 Oct '12

Dear Sir /Mam, I am new to Chimera and thus facing problems in inserting Metal in my protein. I am using the Build structure command in Chimera but I am unable to move the metal from one place to the other. Please guide me out in fixing the metal. -- Yours Sincerely, ~~~~~~~~~~~~~~~~~~~~~~~~ Amit Jaiswal, Department of Bioinformatics, School of Life Sciences, Pondicherry Central University, Kalapet, Pondicherry, Puducherry - 605 014. Phone No.: +91 8124954834. ~~~~~~~~~~~~~~~~~~~~~~~~~

3 3

pipes and planks
by Ishu Saraogi 23 Oct '12

23 Oct '12

Dear Chimera Users: I have been trying to makes pipes and planks in different colors for a co-crystal structure. I want each protein to be a certain color. The user manual says that I need to select "No colors" in the pipes and planks menu. However, this button is deactivated in my program. Has anyone else had that problem and is there a fix? I have tried using axes/planes command but it does not give me loops and sheets that I also need. Any advice will be greatly appreciated. Thanks! Ishu -- Ishu Saraogi, Ph.D. Postdoctoral Scholar California Institute of Technology 1200 E. California Blvd., MC 147-75 Pasadena, CA 91125-4100 USA Phone: (626)395 4071

2 1

Label help
by Hansen, Bryan (NIH/NIAID) [F] 23 Oct '12

23 Oct '12

Hi all, I was wondering how to increase the font size of the label of an amino acid? I'm guessing this is really simple and I'm just missing something, but any tips are appreciated. Bryan

2 2

scripting problem
by Strotz von Moos Dean 22 Oct '12

22 Oct '12

Hi, I have a question to the following code. I can not figure out why certain atom types are not understood (HG, QD etc). The atom types occur in the structure and I can select them through the terminal or add them as pseudo bonds through the pseudoBond reader. For a QD1 one for instance I get: KeyError: 'QD1' <module> grp.newPseudoBond(res[r1].atomsMap[A1][0],res[r2].atomsMap[A2][0]) Excerpt from the input file: 7 HA 7 H red #this is understood 7 H 7 QD1 yellow #error message for QD1 What is wrong with my code? The A1 = str(A1) ? How would I do it alternatively? All the best and many thanks Dean import chimera from chimera.colorTable import getColorByName from chimera.misc import getPseudoBondGroup from chimera import runCommand as rC # use 'rc' as shorthand for runCommand model = chimera.openModels.open('xxx.pdb') rC('show #0') rC('ribbon') rC('ribcolor gray') rC('background solid white') rC('unset depthCue') ins = open('pseudobondsToAdd.txt', "r" ) array = [] for line in ins: array.append(line) ins.close() for line in array: r1, A1, r2, A2, c = line.split() # Split the line on white space. r1 = int(r1) r2 = int(r2) A1 = str(A1) A2 = str(A2) c = str(c) res = model[0].residues grp = getPseudoBondGroup("mybonds", associateWith=model) grp.newPseudoBond(res[r1].atomsMap[A1][0],res[r2].atomsMap[A2][0]) grp.color = getColorByName(c) ETH Zürich Dean Strotz Laboratorium f. Physikalische Chemie HCI F 217 Wolfgang-Pauli-Str. 10 8093 Zürich E-Mail: dean.strotz(a)phys.chem.ethz.ch<mailto:dean.strotz@phys.chem.ethz.ch>

2 3

Show molecular surface for one chain only
by Hurt, Darrell (NIH/NIAID) [E] 22 Oct '12

22 Oct '12

Hi Chimera folks, I have a peptide bound to a protein. They are two separate chains in single PDB. I want to show the molecular surface for the protein, but not the peptide (to see the surface where the peptide binds to the protein). This is easy (the default, actually) for small molecules. But when I select the chain of the protein and display its surface, the surface is "broken" around the peptide and I cannot see what I want. The rest of the surface is OK, but in the area of interest, I cannot see the surface. I tried the "Intersurf" command and it sort of works, but I want an MSMS molecular surface of the protein with the peptide sitting in it. Is there some trick for this other than separating the peptide from the protein and putting it into a separate model? Thanks, Darrell Darrell Hurt, Ph.D. Section Head, Computational Biology Bioinformatics and Computational Biosciences Branch (BCBB) OCICB/OSMO/OD/NIAID/NIH 31 Center Drive, Room 3B62B, MSC 2135 Bethesda, MD 20892-2135 Office 301-402-0095 Mobile 301-758-3559 http://bioinformatics.niaid.nih.gov (Within NIH) http://exon.niaid.nih.gov (Public) Disclaimer: The information in this e-mail and any of its attachments is confidential and may contain sensitive information. It should not be used by anyone who is not the original intended recipient. If you have received this e-mail in error please inform the sender and delete it from your mailbox or any other storage devices. National Institute of Allergy and Infectious Diseases shall not accept liability for any statements made that are sender's own and not expressly made on behalf of the NIAID by one of its representatives.

2 2

Feature request: changing default color for H-bonds
by Miguel Ortiz Lombardía 21 Oct '12

21 Oct '12

Hi, I think the subject of the message is explicit enough... Perhaps the option of having a default color different than cyan for hydrogen bonds already exists, but I have failed to find it. I have this line in my .chimera/preferences file: 'FindHBonds': {'line width': 2.0}, So I tried to include something like 'color: (0.0, 0.0, 0.0, 1.0)' (or bond color or H-bond color...) in the FindHBonds dictionary, alas without success. Let me give some rationale: I prefer having a white background, against which cyan is not really very visible when the structure gets complex. Not to me eyes at least. Thank you! Best regards, -- Miguel Architecture et Fonction des Macromolécules Biologiques (UMR7257) CNRS, Aix-Marseille Université Case 932, 163 Avenue de Luminy, 13288 Marseille cedex 9, France Tel: +33(0) 491 82 55 93 Fax: +33(0) 491 26 67 20 mailto:miguel.ortiz-lombardia@afmb.univ-mrs.fr http://w2.afmb.univ-mrs.fr/Miguel-Ortiz-Lombardia

2 2

coloring 3D maps according to local cross-correlation fit of docked PDB structures
by Jean-Francois Menetret 19 Oct '12

19 Oct '12

Dear users, we would like to color a Cryo-EM map according to the cross-correlation fit of docked PDB structures. Is that possible in Chimera ? Best wishes J-F Menetret

2 3

H-bonds - molecules selection questions
by Marek Maly 18 Oct '12

18 Oct '12

Hello all, #1 I am just curious if it is in Chimera implemented possibility to select all the molecules which are connected via H-bonds with previously selected ("primary") molecule. If it is not implemented I would vote for putting it in the developers queue as it would allow to show easily and clearly (after action command "show selected only") just all the molecules from the given solution directly interacting with previously selected "primary" molecule and it would be a nice and useful feature I think. Perhaps the optimal solution would be to add into "H-bond Parameters" table an additional "clik choice" which would ensure (if marked) that together with visualizing of all H-bonds (defined in the table) will be also selected all molecules which are connected by that H-bonds. (as the supplementary option might be eventually selection of end residues only (not whole molecules) which might be also useful in some cases) #2 Similarly would be cool to have in menu-table "Select -> Zone..." except "Select all atoms/bonds of any residue in selection zone" also possibility like: "Select all atoms/bonds of any MOLECULE having at least one atom in selection zone". Then again using the action "show selected only" one might have quick and nice picture only of all and WHOLE molecules which are in the defined neighbourhood of the initially selected "primary" molecule. #3 Perhaps is it shame :)) but until now I was not able to find the right button to clear/delete previously visualized H-bonds. So my solution (probably not so much elegant) is that I simply select one atom (which is really not the candidate for H-bond ) like C atom and then I ask to visualize all H-bonds which has this atom as the one end. So naturally no H-bond is found and if I do not mark "Retain currently displayed H-bonds" also the previously visualized H-bonds are deleted. But perhaps there is more elegant solution, if not button so at least some command ? Thanks in advance ! Best wishes, Marek

4 5

Three-dimensional surface trace
by Larsson, Per (pl6n) 18 Oct '12

18 Oct '12

Dear Chimera-users I have a problem that I'm not sure can be solved in Chimera, but I thought I'd put the questions out there. Have search the archives, but couldn't turn up anything really relevant. I have a set of pdb-structures (snapshots of the same protein from a molecular dynamics simulation). The protein sits in a membrane and has a bunch of floppy loops that protrude into the solvent region. My aim is to be able to make a plot (in 3D) of the space explored by these loops over the entire simulation, essentially to see if some regions of space are preferred over others. What I thought of doing was to calculate the surface regions traced out by the loops projected on the half-sphere formed by the membrane in the x-y-plane and z>0. I hope that makes sense! Is something like this even possible in Chimera, or should I look elsewhere for a solution (perhaps inventing my own method?) Thanks /Per Larsson, University of Virginia

2 1

Re: [Chimera-users] multialign
by Tom Goddard 17 Oct '12

17 Oct '12

Hi Ed, I don't know if more than one chain can be associated with a sequence in Multalign Viewer. The documentation says " A structure (even if it has multiple chains) cannot be associated with more than one sequence, but a single sequence can be associated with more than one structure." http://www.cgl.ucsf.edu/chimera/docs/ContributedSoftware/multalignviewer/mu… That doesn't really say whether multiple chains of a single structure can associate with a sequence, only that multiple structures (different PDB models) can associate with the same sequence. So I tried it as I'm sure you did and I was not able to make it associate more than one chain (I used groel 1grl) with the same sequence in a multiple alignment. When I load the structure it associates chain A but not any of the other chains. Then if I use MultAlign Viewer menu Structure / Associations... to associate chain B with the same sequence then it seems to lose the association of chain A. At least when I select residues on the sequence, only chain B on the structure has residues selected. I'm forwarding this to the Chimera list since Elaine Meng or Eric Pettersen will have a better answer. Tom > Hi, > I am wondering if this is a bug or limitation in Chimera, or if I am > missing something. I have a molecular model of F-actin, with many > identical chains. Using the Multialign Viewer, it appears that I can > only do a 1 to 1 mapping of a single chain to a single sequence. How > can I map 10 identical chains to one sequence? > Regards, > Ed > -- > > <imap://goddard@imap.sonic.net:993/fetch%3EUID%3E.INBOX%3E23891?header=quotebody&part=1.2.3&filename=signature.html> > > Edward H. Egelman, Ph.D. > > Professor > > Dept. of Biochemistry and Molecular Genetics > University of Virginia >

3 2

(no subject)
by Ondřej Holas 17 Oct '12

17 Oct '12

Greetings, I have encountered this problem with energy minimization of pyrazinamidase molecule. This molecule contains within its structure iron atom which Chimera does not support. Therefore I cannot find the way to overcome this problem. Is there any way to add iron to supported elements or any other way to solve this? Best regards -- Ondrej Holas Ph.D. Department of Pharmaceutical Chemistry and Drug Control Faculty of Pharmacy Heyrovského 1203 500 05 Hradec Kralove Czech Republic

2 1

Need Information
by wisdom＠sanbi.ac.za 16 Oct '12

16 Oct '12

Hi, I am Wisdom, an MSc Bioinformatics student of the University of the Western Cape, South Africa. I wish to understand the meaning of the colouring of the individual amino acids in the sequence window of multiple sequence alignment as per the attached. I one see that all the Rs indicated by the black arrow are all red while the blue arrow has black Rs and orange Gs in the same column. There are other similar coloring all over the alignment. What does each (green, black, blue, orange, purple,red ) colour represent? Thanks Wisdom

2 1

density maps & sub-region selection.
by Hernando J Sosa 16 Oct '12

16 Oct '12

Hi, I am trying to select subregions in two density maps using the subregion selection option in the volume viewer. When selecting the same subregion different sub-volumes in the two maps are selected (there is a displacement between the ROIs along the Z axis) even though the two maps are aligned to each other (or appear to be aligned in the display window). Both maps are in the MRC format and both have a voxel size of 2A/pix. ? Ideally what I want to do is to select equivalent regions of the two maps and then save them as new density maps. How can I best do this? Thanks Hernando. UCSF Chimera version alpha 1.7 (build 36659) on Windows 7 64b

3 2

Trajectories, movies and multi-scale models
by Evan Kantrowitz 15 Oct '12

15 Oct '12

Hi I have a series of pdb files corresponding to a quaternary conformational change involving 12 chains. I can read these pdb files into Chimera via the MD movie, and I can view the conformational change. What I would like to do is to convert the movie into one using multiscale models with one surface for each chain. If I go into multiscale I can convert the initial pdb to multiscale, but it does not carry over to the other pdb files corresponding to the conformational change. Any suggestions would be appreciated. Evan Kantrowitz ------------------------------------------------------------------- Evan R. Kantrowitz, Ph.D evan.kantrowitz(a)bc.edu Boston College Tel. 617-552-4558 Department of Chemistry FAX 617-552-2705 Merkert Chemistry Center, Rm 239 www2.bc.edu/~kantrow Chestnut Hill, MA 02467 -------------------------------------------------------------------

2 1

Re: [Chimera-users] Any option for terminating minimization without losing prior iterations?
by Elaine Meng 12 Oct '12

12 Oct '12

On Oct 11, 2012, at 5:42 PM, Thomas W. Sturgill wrote: > Dear Elaine, > Is there a way to interrupt minimization run without losing everything? > Is this running on the laptop or at a computer at UCSF? > Any link to list of your prior answers to questions on the minimization? > Thank you, > Tom Sturgill Hi Thomas, There is no "restart" if you interrupt the minimization, but you will still have the coordinates of the last update (you don't lose everything). The calculation runs on your own computer. You can see the minimization help by clicking the Help button on the GUI, or using command "help minimize". <http://www.cgl.ucsf.edu/chimera/docs/ContributedSoftware/minimize/minimize.…> Please send Chimera questions to chimera-users(a)cgl.ucsf.edu instead of to me personally -- the chimera-users messages can be searched (for example, for "minimization"): <http://www.cgl.ucsf.edu/chimera/docs/feedback.html> Best, Elaine ----- Elaine C. Meng, Ph.D. UCSF Computer Graphics Lab (Chimera team) and Babbitt Lab Department of Pharmaceutical Chemistry University of California, San Francisco

2 2

Depicting buried surfaces
by Tom Goddard 12 Oct '12

12 Oct '12

> Hi Tom, > I have a non-EM density question! > Is there a way to display the buried surface between two PDB chains in Chimera? Something like what GRASP does: > http://www.csb.yale.edu/poststructure/grasp/grasp2.html > > I know I can measure the area with: > "measure buriedArea :.A :.B" > but is there a way to display the buried surfaces? > Thanks! > -gabe > > Hi Gabe, The measure buriedArea command sets a value for each atom giving the area buried (square Angstroms). So you can use measure buriedArea :.A :.B surfcat a :.A surfcat b :.B color pink :.A color lightblue :.B surface @/buriedSESArea>1 The surfcat command just defines chains A and B as two different objects for surfacing and the surface command show the surface patches associated with all atoms having buried solvent excluded surface area greater than 1 square Angstrom. It shows the entire patch of area for those atoms, not just the part that is buried. So it is pretty ugly and a bigger surface then just the buried part. For a much prettier picture but a slightly different measurement you might try instead split #0 surface measure contactArea #0.1 #0.2 2 slab 0.5 The split puts chains A and B in two models #0.1 and #0.2. The "surface" makes surfaces on each. And the "measure contactArea..." finds all points on one surface within 2 Angstroms of any point on the other surface and displays a pretty looking slab depicting the surface (attached picture). This is a different definition of buried area but might do. http://www.cgl.ucsf.edu/chimera/current/docs/UsersGuide/midas/measure.html#… Tom

2 1

Sybyl - Amber atom type dictionary
by Nikolay Igorovich Rodionov 12 Oct '12

12 Oct '12

Hi all, I was wondering if there is a text editor readable dictionary file that shows Sybyl atom types and their complementary Amber/GAFF atom types names inside the Chimera program contents folder. Thanks, Nikolay Rodionov Nikolay Rodionov| MBA Candidate & B.S. Bioengineering 2015 Martin J. Whitman School of Management & L.C. Smith College of Engineering at Syracuse University Syracuse, New York 13244 Phone: 281.301.9401| Email: Nirodion(a)syr.edu

2 1

Re: [Chimera-users] APBS interface in Chimera
by Elaine Meng 11 Oct '12

11 Oct '12

Hi Boaz, It is brand new, so you have not at all been negligent! I only documented it a few days ago. <http://www.cgl.ucsf.edu/chimera/docs/ContributedSoftware/apbs/apbs.html> Currently it does not have the option to use a locally installed APBS -- it uses an APBS web service provided by the National Biomedical Computation Resource. Best, Elaine ---------- Elaine C. Meng, Ph.D. UCSF Computer Graphics Lab (Chimera team) and Babbitt Lab Department of Pharmaceutical Chemistry University of California, San Francisco On Oct 8, 2012, at 9:24 AM, Boaz Shaanan wrote: > Hi, > Totally due to my negligence I've only just discovered the long sought APBS interface in the daily build (the one I'm using is from 25/9). Well done Chimera and APBS teams! > > Practical question: I don't see on the APBS pull-down menu where I define the location of the executable (I'm talking about the Windows version right now, soon I'll try the linux version too). Is it clever enough to find it wherever APBS is installed or have I missed something? > > Cheers, > Boaz

4 3

How to change the font for residue label
by Jean Didier Pie Marechal 11 Oct '12

11 Oct '12

Hi, I would like labels to appear bigger like with a bold font. How is that possible? Best JD Dr. Jean-Didier Maréchal Lecturer The Computational Biotechnological Chemistry Team Unitat de Química Física Departament de Química Universitat Autònoma de Barcelona Edifici C.n. 08193 Cerdanyola (Barcelona) Tel: +34.935814936 e-mail: JeanDidier.Marechal(a)uab.es www: http://asklipio.qf.uab.es ----- Missatge original ----- De: chimera-users-request(a)cgl.ucsf.edu Data: Dimecres, Octubre 10, 2012 9:00 pm Assumpte: Chimera-users Digest, Vol 114, Issue 11 > Send Chimera-users mailing list submissions to > chimera-users(a)cgl.ucsf.edu > > To subscribe or unsubscribe via the World Wide Web, visit > http://plato.cgl.ucsf.edu/mailman/listinfo/chimera-users > or, via email, send a message with subject or body 'help' to > chimera-users-request(a)cgl.ucsf.edu > > You can reach the person managing the list at > chimera-users-owner(a)cgl.ucsf.edu > > When replying, please edit your Subject line so it is more specific > than "Re: Contents of Chimera-users digest..." > > > Today's Topics: > > 1. Re: Coloring nucleic acid ladder with opacity. Possible bug? > (Tom Goddard) > > > -------------------------------------------------------------------- > -- > > Message: 1 > Date: Wed, 10 Oct 2012 10:04:13 -0700 > From: Tom Goddard <goddard(a)sonic.net> > To: Rebecca Swett <rswett(a)chem.wayne.edu> > Cc: chimera-users(a)cgl.ucsf.edu > Subject: Re: [Chimera-users] Coloring nucleic acid ladder with > opacity. Possible bug? > Message-ID: <5075AA8D.5050304(a)sonic.net> > Content-Type: text/plain; charset=ISO-8859-1; format=flowed > > Hi Rebecca, > > I put in a fix so that nucleotide ladder transparency looks right > in > tonight's daily builds. The fix applies to all Chimera VRML models > when > single-layer transparency is used. If multi-layer transparency is > used > then the opacity times the red,green,blue values of all transparent > layers are added together without regard to which layers are in > front of > which other layers, and that will still produce overly bright and > incorrect transparency. That is hard to fix. The single-layer > transparency mode is the default in Chimera 1.6 and later. > > Tom > > -------- Original Message -------- > Subject: Re: [Chimera-users] Coloring nucleic acid ladder with > opacity. > Possible bug? > From: Tom Goddard > To: Rebecca Swett > Date: 10/9/12 6:11 PM > > Hi Rebecca, > > > > Transparency does not work well with Chimera's nucleotide > > representations (slabs, ladder). Here's a technical explanation > that > > may help you understand why you see what you see. The > transparent > > nucleotide ladder is shown by multiplying the red, green, blue > color > > components (range 0 to 1) by the opacity (= 1 - transparency) and > > those color values are simply added to the image. Even in > > single-layer transparency mode both the back and the front of the > > cylinders are being added which makes the colors twice as bright > as > > they should be and can make it appear entirely white if rgb > values all > > end up greater than 1. > > > > This is a defective way to show something transparent. > Nucleotides > > are drawn as "VRML" models and all such Chimera models have this > > deficiency. Normal surfaces and molecules in Chimera do not have > this > > problem with transparency. It may be possible to fix the VRML > > transparency so it respects the "single-layer transparency" > option and > > that would make it much better since front and back side colors > would > > not get added creating an overly bright (sometimes white) > appearance.> > > Tom > > > > > > -------- Original Message -------- > > Subject: Re: [Chimera-users] Coloring nucleic acid ladder with > > opacity. Possible bug? > > From: Greg Couch > > To: Rebecca Swett > > Date: 10/9/12 5:31 PM > >> It's not a feature. :-) For me, transparency for ladder rungs > kinda > >> works -- the rungs are transparent, but not enough. And I only > see > >> opaque white when the ladder rungs are facing the key light. You > >> could mitigate the opaque white by moving the model or the key > >> light. If you are seeing different results or if you're > interested > >> in being notified after the bug is fixed, please file a bug report. > >> > >> FYI, in the Chimera daily build (available tomorrow), I've > eliminated > >> the extra cylinder caps that are exposed when you make the > ladder > >> transparent, so you can get a slightly better picture. > >> > >> HTH, > >> > >> Greg > >> > >> On 10/07/2012 07:01 PM, Rebecca Swett wrote: > >>> Hey all, quick question on coloring here. I'm handling a > structure > >>> that has nucleic acids and protein. I'd like to represent the > >>> nucleic acids with the ladder representation and then have them > at a > >>> lower opacity to bring focus to the protein structure. When I > try > >>> coloring the ladder with opacity, the ribbons color just fine, > but > >>> the rungs go opaque white. Is this a bug, or has anyone gotten > this > >>> to work? I just updated to 1.6.2. Thanks for any help. > >>> ~Rebecca > >>> > >>> Rebecca Swett > >>> Wayne State University > >>> 357 Chemistry > >>> Detroit, MI 48201 > >>> > >>> Lab Phone 313-577-0552 > >>> Cell Phone 906-235-0768 > >> > > > > ------------------------------ > > _______________________________________________ > Chimera-users mailing list > Chimera-users(a)cgl.ucsf.edu > http://plato.cgl.ucsf.edu/mailman/listinfo/chimera-users > > > End of Chimera-users Digest, Vol 114, Issue 11 > ********************************************** >

2 1

(no subject)
by Francesco Pietra 10 Oct '12

10 Oct '12

Hello: chimera production version 1.6.2 (build 36855) 2012-07-06 17:55:00 UTC is unable to restore *.py files saved with chimera alpha version 1.7 (build 36726) 2012-06-21 01:06:17 UTC on another computer. Both computers running GNU-Linux Debian amd64 wheezy.. Error message "cannot open session that was saved in a newer version of Chimera; update your version" Does "alpha version" override date and stable compilations? The unable version has a more recent date. Then, I have installed the latest stable version of chimera, and the error was the same. Thanks for advice francesco pietra

3 2

distance dash line thickness in rendering
by Andrew Waight 10 Oct '12

10 Oct '12

Howdy everyone, I love this program! Anyway I'm trying to make some figures with distance dashes included. I can obviously change the line thickness (pseudobond display options) in the program, but when I save a high resolution image (no pov ray) the line thickness in has no effect. What to do? Thanks for your help. Drew Waight Stroud Lab Genentech Hall S414

5 5

Met CH3 and NH3+ hydrogen optimization
by Visvaldas K. 09 Oct '12

09 Oct '12

Dear colleagues, Regarding H addition to protein structures, there are indications that hydrogens of NH3+ groups of lysine or N-termini, and side chain methyls of methionines need a rotational optimization (Richardson & Richardson, Chapter 15 in "Structural Bioinformatics", 2nd ed., 2009, p. 380) . I think this problem is not too common, but I did encounter it at least once when I had to rotate manually a Methionine methyl to remove a clash with the ligand. I think Chimera doesn't perform this optimization, or does it? If it doesn't, perhaps this could be put on a list of future improvements:) Best regards, Vis Kairys Institute of Biotechnology Vilnius University

3 2

surface texture export
by Laura Lynn Gonzalez 09 Oct '12

09 Oct '12

Hi. Is there any way to export Coloumbic colored surfaces as JPG textures when you export geometry (obj, vrml, etc)? Or get the 3D texture data in some other format? I'm trying to import my Coulombic-colored protein into a 3D program. -Laura Lynn

3 3

Re: [Chimera-users] APBS interface in Chimera
by Baker, Nathan 08 Oct '12

08 Oct '12

Hi Boaz -- That was news to me as well; thanks for making me aware of this! Best, -- Nathan Baker Pacific Northwest National Laboratory Tel: +1-509-375-3997 http://nabaker.me From: Boaz Shaanan <bshaanan(a)exchange.bgu.ac.il<mailto:bshaanan@exchange.bgu.ac.il>> Date: Monday, October 8, 2012 11:24 AM To: "chimera-users(a)cgl.ucsf.edu<mailto:chimera-users@cgl.ucsf.edu>" <chimera-users(a)cgl.ucsf.edu<mailto:chimera-users@cgl.ucsf.edu>> Cc: Nathan Baker <nathan.baker(a)pnnl.gov<mailto:nathan.baker@pnnl.gov>> Subject: APBS interface in Chimera Hi, Totally due to my negligence I've only just discovered the long sought APBS interface in the daily build (the one I'm using is from 25/9). Well done Chimera and APBS teams! Practical question: I don't see on the APBS pull-down menu where I define the location of the executable (I'm talking about the Windows version right now, soon I'll try the linux version too). Is it clever enough to find it wherever APBS is installed or have I missed something? Cheers, Boaz Boaz Shaanan, Ph.D. Dept. of Life Sciences Ben-Gurion University of the Negev Beer-Sheva 84105 Israel E-mail: bshaanan(a)bgu.ac.il<mailto:bshaanan@bgu.ac.il> Phone: 972-8-647-2220 Skype: boaz.shaanan Fax: 972-8-647-2992 or 972-8-646-1710

1 0

Re: [Chimera-users] using modeller through chimera
by Elaine Meng 08 Oct '12

08 Oct '12

On Oct 8, 2012, at 2:21 AM, Taufiq Rahman wrote: > Just wonder whether in using modeller through Chimera interface, we can use our own alignment file or not. Hi Taufiq, Yes, you can definitely use your own alignment file -- just open it in Chimera. To run Modeller using the Chimera interface, all you need is a sequence alignment of target and template (and if it has additional sequences, that is fine) plus the template structure, both opened in Chimera. There are several ways of obtaining these inputs, outlined here: <http://www.cgl.ucsf.edu/chimera/docs/ContributedSoftware/multalignviewer/mu…> See the third one, "using a pre-existing target-template sequence alignment" Regards, Elaine ---------- Elaine C. Meng, Ph.D. UCSF Computer Graphics Lab (Chimera team) and Babbitt Lab Department of Pharmaceutical Chemistry University of California, San Francisco

2 1

НА: Chimera --send on MacOS
by Sp 07 Oct '12

07 Oct '12

Отправлено с моего коммуникатора HTC

1 0

Re: [Chimera-users] Chimera-users Digest, Vol 114, Issue 2
by Pu Qian 05 Oct '12

05 Oct '12

Hi, I'm working on a big protein complex with MW ~500 kD. It contains a cave inside of the protein. Now I would like to high light this cave so that I can show the room that is big enough for a quinone molecule to move. Question is: is there a function in Chimera which allows users to produce such cave inside of the protein based on PDB file of the protein. If is, where can I find it and how to use it. It would be a great appreciated if anyone here could give me advices. Thanks. Best regards Dr. Pu Qian Department of Molecular Biology The University of Sheffield Sheffield, S10 2TN UK

2 2

Chimera --send on MacOS
by François Stricher 04 Oct '12

04 Oct '12

Hi all, I want to be able to interact with Chimera from another program, sending commands and all. I tried the chimera --send my_file.com to test it under MacOS 10.7. Each time I do this, it opens a new instance (instead of reusing the previous one) and doesn't process my_file.com at all. When I open my_file.com from inside chimera, it operates the commands inside it without any problem. Any idea? Francois

2 4

Global and per-user preference files?
by mike _ 03 Oct '12

03 Oct '12

I wish to deploy a Chimera installation across multiple machines for multiple users. For obvious reasons the users will not have write permission on the application directory. In this scenario Chimera's default behaviour of regularly checking for updates is unhelpful so I wish to disable it. Having read http://www.cgl.ucsf.edu/chimera/docs/UsersGuide/preferences.html#Preferences I assumed I could disable the update checking by putting a suitable preferences file in the application directory and then having users invoke Chimera in such a way that preferences file is found. That works, but generates a warning that the preferences file is read-only (which it is, it's in the application directory) and Chimera seems to only want to use the one preferences file. So the result is that users can't save any preferences. Is there any way to make Chimera read a global preferences file that contains some useful defaults and also allow each user to have their own preferences file? thanks, mike

2 1

Re: [Chimera-users] using modeller through chimera
by Elaine Meng 03 Oct '12

03 Oct '12

Hi Taufiq, As you mentioned, the models will appear automatically in the Chimera main window, and there will be an additional dialog, Modeller results (a list of the homology models and other information). For example, the two bottom figures in the Comparative Modeling tutorial show this dialog: <http://www.cgl.ucsf.edu/chimera/docs/UsersGuide/tutorials/dor.html> I don't understand what you are clicking... it should not be necessary to click anything. More details about the Modeller results dialog: <http://www.cgl.ucsf.edu/chimera/docs/UsersGuide/modbase.html#modellist> Best, Elaine On Oct 3, 2012, at 6:16 AM, Taufiq Rahman wrote: > Dear Elaine, Many thanks for the reply. It was very helpful and I can now do it. The only fresh problem is: whenever Modeller seems to complete the job (I assume), I can't click on 'modeller results' - its there but clicking on it doesn't open up anything, whilst in the 3d space, I can see the modelled structure as well as the templates. > Any advice? > Regards, > taufiq > > On Oct 3 2012, Elaine Meng wrote: > >> Hi Taufiq, It is probably disabled because you are viewing a single sequence rather than an alignment of 2 or more sequences. In Chimera, there are several ways to get the needed inputs for Modeller, which include the sequence alignment and a structure to use as the template. Some ways are outlined here: >> >> <http://www.cgl.ucsf.edu/chimera/docs/ContributedSoftware/multalignviewer/mu…> >> >> Once you have the inputs, you can run Modeller either via web service or via your local installation. If you haven't already, you would also need to obtain a Modeller license key before running (even if you are going to use the web service). >> >> I would also recommend that you get a newer version of Chimera (at least 1.6.2). The Modeller interface is improved in that version compared to older versions. The sequence window menu will then include both "Structure... Modeller (homology)" and "... Modeller (loops/refinement)" instead of a single "...Modeller Tools" entry. >> >> This documentation is for 1.6.2: <http://www.cgl.ucsf.edu/chimera/docs/ContributedSoftware/multalignviewer/mo…> >> >> I hope this helps, >> Elaine >> ----- >> Elaine C. Meng, Ph.D. UCSF Computer Graphics Lab (Chimera team) and Babbitt Lab >> Department of Pharmaceutical Chemistry >> University of California, San Francisco >> >> On Oct 2, 2012, at 7:49 AM, Taufiq Rahman wrote: >> >>> Hello, I want to use modeller through Chimera's interface. I have seen the video and read about the way to do it. My problem is my 'modeller tool' option in the structure menu remains disabled. I have installed modeller locally but don't know how to integrate it into chimera. >>> any suggestion? >>> taufiq >> >> > > -- > Taufiq Rahman > MSc(Manchester), PhD (Cantab) > Royal Society University Research Fellow > University of Cambridge > Cambridge > CB2 1PD > UK >

2 1

using modeller through chimera
by Taufiq Rahman 03 Oct '12

03 Oct '12

Hello, I want to use modeller through Chimera's interface. I have seen the video and read about the way to do it. My problem is my 'modeller tool' option in the structure menu remains disabled. I have installed modeller locally but don't know how to integrate it into chimera. any suggestion? taufiq

2 1

crystal structure reconstruction
by rainy908＠yahoo.com 01 Oct '12

01 Oct '12

Hi, I am new to Chimera. I have a PDB of a protein comprising of a loop region that appears to have slight alpha-helical behavior when visualized in Pymol. However, I doubt that this region is actually structured, and that this alpha-helical behavior is actually an artifact from experimental conditions. To double-check the validity of this loop, I was broadly advised that "crystal structure reconstruction" can be performed in Chimera. I suspect this is either the 'molmap' or "Fit in Map" feature? Sincerely, Lili

2 3

Error inizializing OpenGL
by Francesco Pietra 01 Oct '12

01 Oct '12

Hello: Following and upgrading of Debian GNU-Linux i386 testing (= wheezy) of my old PC francesco@deb32:~$ lspci | grep VGA 01:00.0 VGA compatible controller: NVIDIA Corporation NV11DDR [GeForce2 MX200] (rev b2) francesco@deb32:~$ with modern kernel francesco@deb32:~$ uname -r 3.2.0-3-686-pae francesco@deb32:~$ chimera francesco@deb32:~$ chimera --version chimera production version 1.6.1 (build 35849) 2012-03-13 22:24:07 UTC francesco@deb32:~$ does not start anymore: Error inizializing OpenGl. Couldn't configure togl widget. Before I go messing the system, may be I can get advice on where to put the hands. libgotl is not installed, but the same occurs with my GTX-680 amd64 system, where chimera works fine. Thanks francesco pietra

2 1

Re: [Chimera-users] [chimera-dev] The style of Ribbon in alpha 1.7 version
by Elaine Meng 29 Sep '12

29 Sep '12

Hi Cheng, Actually the ribbon shape has not changed, but a bug in the lighting that made the ribbon look rounder than it really was has been fixed. (see release notes "general changes" http://www.cgl.ucsf.edu/chimera/docs/relnotes/snapshot.html#general ) You could use Ribbon Style Editor to make something that looks more similar to the old ribbon. I tried making a ribbon style shaped like a football (named "football") and combined that with a ribbon scaling with larger height for helix, sheet, and arrow base (named "fat"). I wasn't very careful drawing the football so you could probably make it better by drawing it more carefully. I attached a file you could use as your preferences file (although you would then lose your own earlier preferences), or you could text-edit to insert all of the lines in the attached file *except* the top and bottom lines into your existing preferences file. Either way, you should save a copy of your existing preferences file first so you don't lose your settings. Or, you could just make a fatter scaling and football-shaped cross section (style) in Ribbon Style Editor yourself, without using the attached file. If you do use the attached file, you could apply everything with commands: ribscale fat ribrepr football Chimera-dev is for programming questions - I'll CC the chimera-users email address since that is more appropriate for this issue, and others on the list may be interested. Best, Elaine ----- Elaine C. Meng, Ph.D. UCSF Computer Graphics Lab (Chimera team) and Babbitt Lab Department of Pharmaceutical Chemistry University of California, San Francisco On Sep 29, 2012, at 3:17 PM, Cheng Wang wrote: > Dear Chimera Team, > Hi. > The ribbon style in 1.6 version is a little round for helix, while it is really flat in 1.7 version. I want to use v1.7 since several commands are really good for movie making eg. format option and transparency. However the ribbon style for helix is not as nice as it in 1.6. I am wondering how could I change the style of ribbon in 1.7 to be the same as in 1.6 since the ribbon style seams the same in the panel for both versions. > Many thanks. > Best, > Cheng

1 0

Specifying colour of surface cap when surface coloured by electrostatic potential
by Ashley Pike 28 Sep '12

28 Sep '12

Hi - Can't find answer to this question in manual. Is it possible to assign a uniform solid colour to a surface cap when the (clipped) surface is coloured by electrostatic potential (using external .dx file)? I know such capping can be done when the surface is coloured by some other attribute but have not found a way to specify in the above case. Any hints gratefully received. Many thanks, Ashley -- Dr. Ashley Pike Membrane Protein Crystallography | Structural Genomics Consortium | University of Oxford

2 3

Silhouette color change
by vamsee 27 Sep '12

27 Sep '12

Hi Elaine, I need to change the silhouette color of individual models and if possible for individual representations (ribbon, surface or atoms). Is there a command line option that I could use? (maybe set?) Thanks in advance Vamsee

2 1

Measuring angles between atoms pairs
by Yasser Almeida Hernandez 26 Sep '12

26 Sep '12

Dear Chimerians... I'm running an analysis about H-bonds geometries in several models. I need to measure the distance of a H-bond and the angle formed with a third atom bonded to one of the H-bond atoms. How could I do that in a python IDLE/script? In a more general way, how could I measure the angle between three atoms linked by a bond o pseudobond? Thanks in advance Yasser -- Yasser Almeida Hernández, BSc. Center of Molecular Immunology (CIM) Tumor Biology Department 216 St.& 15th Ave, Siboney, Playa P.O.Box 16040, Havana 11600 CUBA Phone: (+53-7) 214-3178 almeida(a)cim.sld.cu<mailto:almeida@cim.sld.cu>

3 2

E. coli cells
by Victor Padilla-Sanchez 24 Sep '12

24 Sep '12

Dear UCSF Chimera, Could you tell me where to find chimera maps of E. coli cell(s) ? Or could you send me some maps ? Thank you very much Victor Padilla-Sanchez

2 1

drawing circles
by Bala subramanian 24 Sep '12

24 Sep '12

Friends, I want to draw concentric circles of increasing sizes around the protein. To achieve this, i used the 'define plane' option to draw disk choosing I three reference atoms and drew the disks of increasing sizes and choose two different color for the inner and outer disk. Since the reference atoms are the same. If i change the color of the bigger disk, i get a weird appearance of the inner disk. I dnt know how to resolve this problem. I would like to know if i can do something like making the disk transparent/removing the fill color of the disk. thanks, Bala -- C. Balasubramanian

4 3

"No MMTK name for atom "H" in standard residue "G" "
by Nikolay Igorovich Rodionov 22 Sep '12

22 Sep '12

Hi could someone help me with this error: No MMTK name for atom "H" in standard residue "G" I get this error when running the minimize structure function. Does anyone know a work around or how I can fix the problem? Nikolay Rodionov Nikolay Rodionov| MBA Candidate & B.S. Bioengineering 2015 Martin J. Whitman School of Management & L.C. Smith College of Engineering at Syracuse University Syracuse, New York 13244 Phone: 281.301.9401| Email: Nirodion(a)syr.edu

2 2

Potential Energy Calculations
by Nikolay Igorovich Rodionov 22 Sep '12

22 Sep '12

Hi all, I was wondering the there is a tool in chimera that can find the net interaction potential energy between models, something like Lennard Jones Potential. Specifically, I need to measure the interaction potential between a protein and water in a solvated system. Thanks! Nikolay Rodionov Nikolay Rodionov| MBA Candidate & B.S. Bioengineering 2015 Martin J. Whitman School of Management & L.C. Smith College of Engineering at Syracuse University Syracuse, New York 13244 Phone: 281.301.9401| Email: Nirodion(a)syr.edu

2 7

Calculation of SASA with probe size of 0.8Å
by Amy Davenport 21 Sep '12

21 Sep '12

Hi all, I am trying to calculate the solvent accessible surface area of my protein. I would like to use a probe radius of 0.8Å to do so, but do not see a way to alter the probe size past what the selectable values are in the structools menu. Additionally, I need all atoms to be included, which means hydrogens as well. Any help would be greatly appreciated. Thank you, Amy Davenport Migliori UCSD

2 3

Estimated RMSD after using Modeller feature
by Claudia Fernandes 21 Sep '12

21 Sep '12

I used Modeller function in Chimera to make some comparative models and then used the estimated RMSD function. I used two querys for different modeling jobs. The original query that was similar to the target I choose and a query that has an extra 26 N-terminus aminoacids than the target I choose. Using the same tamplate, shouldn't the estimated RMSD be the same for the original query and the longer query (with the extra Nterminus aminoacids)? As it isn't, how is it being calculated? I found that the calculation was carried out with TSVMod, but I couldn't find anything about how i does it. Any help would be welcome. Regards, Cláudia Fernandes

2 1

Modeller-Chimera interface
by James Valdes 21 Sep '12

21 Sep '12

Hello Chimera, I'm using the Modeller interface via Chimera and I was wondering if the models produced takes into account multiple templates (e.g., selecting all) from a multiple alignment produced by MAFFT (http://mafft.cbrc.jp/alignment/software/) I appreciate any insight you may provide. Cheers, James Jason Valdés, Ph.D.

2 1

arrow heads for pipes and planks
by Evan Kantrowitz 20 Sep '12

20 Sep '12

Hi, Probably a dumb question, but I cannot figure out how to show arrow heads on pipes and planks. I found this info Show arrow on helix and Show arrow on strand (both default true) place arrowheads on the C-terminal ends of secondary structure elements to indicate N→C directionality. These are not on the pipes and planks tool. What is the format on the command line to use this commands I tried Show arrow on helix Show arrow on helix true Thanks Evan ------------------------------------------------------------------- Evan R. Kantrowitz, Ph.D evan.kantrowitz(a)bc.edu<mailto:evan.kantrowitz@bc.edu> Boston College Tel. 617-552-4558 Department of Chemistry FAX 617-552-2705 Merkert Chemistry Center, Rm 239 www2.bc.edu/~kantrow<http://www2.bc.edu/~kantrow> Chestnut Hill, MA 02467 -------------------------------------------------------------------

2 2

saving a rotated map
by Filip Van Petegem 20 Sep '12

20 Sep '12

Dear chimera users, I have a problem with saving a cryoEM map after rotating/translating it. I've used the 'fit in map' option to superpose 2 maps (in ccp4 format) This seems to work fine, but when I save the reoriented map (in any of the available formats), and try to open it, it is back to the original position. Is there any way to save the reoriented map file? Best regards, Filip Van Petegem -- Filip Van Petegem, PhD Associate Professor The University of British Columbia Dept. of Biochemistry and Molecular Biology 2350 Health Sciences Mall - Rm 2.356 Vancouver, V6T 1Z3 phone: +1 604 827 4267 email: filip.vanpetegem(a)gmail.com http://crg.ubc.ca/VanPetegem/

3 2

solvation box transformed
by Visvaldas K. 20 Sep '12

20 Sep '12

Dear Users, I have some difficulties with reference frames when solvating a protein. The essence of my problem as follows. Chimera solvates a box using _untransformed_ coordinates, but if I try to write out the inpcrd/prmtop, it writes out the _transformed_ coordinates, thus the box planes become no longer parallel to xyz axes, which does not allow to transfer the inpcrd coordinates to another program (NAMD). Of course, I could try a workaround by creating the protein and re-saving it before solvation, and then solvating it while avoiding any mouse movement,or using ambertool cooman line, but maybe there is another solution, or perhaps an "untransformed" button could be implemented in the prmtop tool? Sincerely, Vis

1 1

Chimera running on a remote computer over ssh >>>> use virtualgl to avoid graphics problems
by Dieter Blaas 19 Sep '12

19 Sep '12

Those who encountered lots of problems with the graphics when running chimera remotely for example you receive error messages like this one: X Error of failed request: GLXBadContextTag Major opcode of failed request: 153 (GLX) Minor opcode of failed request: 5 (X_GLXMakeCurrent) Serial number of failed request: 1352 Current serial number in output stream: 1352 might be interested in the following solution: 1) install VirtualGL (http://www.virtualgl.org/) on both PCs 2) outcomment the indicated lines in the 'chimera' startup script 3) connect to the server by using 'vglconnect' 4) start chimera on the server with 'vglrun chimera' that's it! if [ -z "$nogui" ] then case "`uname -s`" in Linux) # preload our C++ runtime to avoid # ATI graphics driver bug # LD_PRELOAD=libotf.so <<<<<<<<< # export LD_PRELOAD <<<<<<<<< if test -e "$CHIMERA/bin/python2.7" then python="$CHIMERA/bin/python2.7" else in those cases where chimera works without this trick you might still see a substancial improvement in transmission speed! Best, Dieter -- ------------------------------------------------------------------------ Dieter Blaas, Max F. Perutz Laboratories Medical University of Vienna, Inst. Med. Biochem., Vienna Biocenter (VBC), Dr. Bohr Gasse 9/3, A-1030 Vienna, Austria, Tel: 0043 1 4277 61630, Fax: 0043 1 4277 9616, e-mail: dieter.blaas(a)meduniwien.ac.at ------------------------------------------------------------------------

2 1

Re: [Chimera-users] chimera utility help
by Elaine Meng 17 Sep '12

17 Sep '12

Dear Sotirios, You would use Join Models option "C-N peptide bond" as described in these instructions: <http://www.cgl.ucsf.edu/chimera/docs/ContributedSoftware/editing/editing.ht…> "C-N peptide bond - specialized case of joining two peptides. The N-terminal N of one peptide and the C-terminal (carbonyl or carboxyl) C of the other should be selected. Each selected atom must be bonded to only one carbon; however, it may also be bonded to hydrogen and/or OXT, and if so, these atoms will be replaced as appropriate by the new peptide bond." If you do not see that option, maybe you have an older version of Chimera and should upgrade to a newer version. If you do see that option and you have followed the instructions as above but are still not able to apply, please save a session file and use menu "Help... Report a Bug" and attach the session file to the bugreport. I just tried it on two example proteins and seemed OK, but maybe there is something different about your structure. Thanks! Elaine ---------- Elaine C. Meng, Ph.D. UCSF Computer Graphics Lab (Chimera team) and Babbitt Lab Department of Pharmaceutical Chemistry University of California, San Francisco On Sep 17, 2012, at 9:10 AM, Sotirios Katsamakas wrote: > Dear Elaine C. Meng, > I followed your suggestion and I created a separate side chain of the 25 amino acids with specified phi and psi values for its residues. But I am still not able to Join Models, through the homonymous section. I am selecting the C terminus of the constructed side chain (#0:25@C) and the N terminus of the protein (#1:26@N) respectively, but when I go to the panel the apply button stays inactive. I am sure it must be something obvious but it eludes me. Thank you in advance and I am looking forward in hearing from you. > > Best Regards, > Sotirios Katsamakas.

1 0

Difference between atoms' coordinates on screen and in a PDB file
by Mateusz Dobrychłop 14 Sep '12

14 Sep '12

Hello, I load 3 protein models into Chimera and enter several "move" commands. The structures change their positions. Then, I save them as a PDB file, and immediately open the PDB file. The structures are not overlapping (screenshot: http://i.imgur.com/gtGBN.png ). Why does it work like this and what can I do to obtain accurate coordinates on my screen without re-opening the model (after I finish my sequence of translations)? Mateusz

3 4

Denaturing a protein
by vamsee 14 Sep '12

14 Sep '12

Hi Elaine, Thanks for the answer for the previous question. I am back with one more :) Is there a way to completely denature a protein in Chimera? The idea is to completely unfold a particular protein (for ex: chemical denaturation GdHCl/Urea or thermal denaturation) to its primary structure. Also can this be modeled in such a way that we can extract thermodynamic parameters from the modeling? I do understand this sounds a lot like a Molecular Dynamics simulation but maybe there is a way in Chimera? Thanks again Vamsee

3 2

sphgen format
by Brian Fochtman 13 Sep '12

13 Sep '12

Hello, I read in the release notes for version 1.6 that Chimera is now able to input files in the dock .sph format. Thank you for this feature, it will be very helpful. Unfortunately I am having some trouble using it. (File -> Open -> file.sph) declares a syntax error for the following file (I've only included the beginning of the file because the output says the synax error is on line 2). Is there another method to read in these files? Thank you, Brian Fochtman cluster 1 number of spheres in cluster 72 1 20.51900 -17.55400 15.86300 0.700 1 2 21.04300 -18.55700 16.07400 0.700 2 3 22.17700 -17.60500 16.24100 0.700 3 4 22.17500 -17.84200 15.30900 0.700 4 5 21.41300 -20.08800 15.15700 0.700 5 6 20.64000 -20.83100 16.58800 0.700 6 7 21.63200 -18.65500 14.15300 0.700 7 8 23.13800 -16.98900 16.54500 0.700 8 9 21.18800 -21.21200 14.71200 0.700 9 10 17.88800 -26.45300 19.89900 0.700 10 11 21.83900 -17.33000 12.81300 0.700 11 12 21.28600 -20.42100 13.28900 0.700 12 13 23.77100 -15.65400 16.91100 0.700 13 14 21.15100 -21.76500 13.92000 0.700 14 15 21.38500 -19.46300 12.20200 0.700 15 16 20.39500 -21.75600 13.41100 0.700 16

2 1

Gromac .xtc format
by Eric Pettersen 13 Sep '12

13 Sep '12

Hi, For you Chimera/Gromacs users out there, the current daily build allows you to use .xtc format coordinates now as an alternative to .trr . --Eric Eric Pettersen UCSF Computer Graphics Lab http://www.cgl.ucsf.edu

1 0

chimera utility help
by Sotirios Katsamakas 13 Sep '12

13 Sep '12

Dear sir or madam, I am a recent user of the chimera software on Linux-Ubuntu (11.10) operating system and I confronted a dead end on the following issue. I reconstructed a missing side chain of 25 amino acids in a PDB file but I cant seem to find how to set the secondary structure and so on for these 25 residues. So they are stuck in a linear formation externaly from my protein. For your consideration I am attaching also the PDB file. Thank you in advance and looking forward in hearing from you regarding my problem. Best Regards, Sotirios Katsamakas

3 2

Re: [Chimera-users] Match->Align command line option?
by Eric Pettersen 12 Sep '12

12 Sep '12

On Sep 12, 2012, at 11:16 AM, Chetanya Pandya wrote: > Hello, > > I want to superimpose multiple structure sets and get the corresponding multiple sequence alignments using Chimera. I've been using the Match->Align option from the Tools menu. Now, I want to automate the process using the Python interface. > > Unfortunately, I'm unable to find a command line option which does this. Can you help me out with this? Hi Chetanya, It's a little ambiguous if you are asking about a command version of Match->Align, or how to call it from Python. The issue is moot though since there currently is no command version of Match->Align, so you have to call it from Python! I don't know how familiar you are with Python or programming with Python, but the Chimera Programmer's Guide has some info to help. http://www.cgl.ucsf.edu/chimera/docs/ProgrammersGuide/index.html If you don't know Python at all, follow the link in the Guide to the Python Tutorial and work through that, or at least the first few sections of that. Then for some Chimera-specific info, look at some of the Examples and the "basic primer" linked on the page. Assuming you've written a script that has gotten to the stage where the structures are already open and superimposed, here's the info you'll need to use the Match->Align API: 1) Getting the list of open molecules: from chimera import openModels, Molecule mols = openModels.list(modelTypes=[Molecule]) 2) Getting the list of chains to use. This example code assumes they're chain A: chains = [m.sequence('A') for m in mols] 3) Call Match->Align to create the alignment. from StructSeqAlign import makeAlignment mav = makeAlignment(chains) Note that the makeAlignment call will only return the Multalign Viewer instance starting with tomorrow's daily build (i.e. I made that change today!). Also, the makeAlignment call has a lot of optional arguments to change the parameters used in computing the alignment (e.g. cutoff, iteration, reference chain). Look at <your Chimera>/share/StructSeqAlign/__init__.py to see what the options are if you need to change the default behavior. (On a Mac, "<your Chimera>" is Chimera.app/Contents/Resources). 4) Save the alignment to a FASTA format file (named "x.fa") and Quit the MAV instance: f = open("x.fa", "w") from MultAlignViewer.formatters.saveFASTA import save save(f, mav, mav.seqs, mav.fileMarkups) f.close() mav.Quit() I hope this helps. Since this is pretty Python-intensive, I set followups to go to the chimera-dev mailing list rather than chimera-users. --Eric Eric Pettersen UCSF Computer Graphics Lab http://www.cgl.ucsf.edu

1 0

Visualization of protein aqueous solution
by Nikolay Igorovich Rodionov 10 Sep '12

10 Sep '12

Hi all, Could anyone tell me how I could solvate my protein in a solution of a specific molarity solution with both water molecules and Na+ Cl- ions. I have no trouble adding the water molecules, but I am not sure how to go about adding the ions into the visualization. I've tried using add-ion but I haven't had good results. Are there any other options? This is for purely visual purposes, I'm creating a conceptual image, so I don't need the system to be 100% accurate or capable of conducting calculations. Much Thanks! Nikolay Rodionov

3 3

color by RMSD
by Daniel Gurnon 10 Sep '12

10 Sep '12

Hi everyone, To color a trajectory by RMSD, comparing each frame to the final frame. My approach was to save the last frame of the trajectory as a pdb, load it as a separate model, and then run something like this script: mm #0 #1 show true rangecolor mavRMSD min white mid pink max red This works, but of course my screen quickly fills with multialign-viewer windows. Without "show true" in the script, coloring doesn't work past the first frame. Is there a way to do this without displaying the MAV window? thanks Dan -- ____________________________ Daniel Gurnon, Ph. D. Associate Professor of Chemistry and Biochemistry DePauw University Greencastle, IN 46135 p: 765-658-6279 e: danielgurnon(a)depauw.edu

2 1

Ribbon gradient coloring
by vamsee 10 Sep '12

10 Sep '12

Hi All, Is there a way to color the ribbon with a gradient? In my case, it has to be an increasing and then decreasing gradient. Ex: Let's say I have data that shows that a certain region of a protein is highly dynamic. This region consists of approx 11 residues and the most dynamic region in these 11 are the residues 5,6 and 7. Now, I need to color the ribbon in such a way that residues 1 and 11 are the same color (green), 2 and 10 (yellow), 3 and 9 (light orange) 4 and 8 (orange) 5,6 and 7 (red). I could do this by coding it but it becomes a step gradient and it doesn't look so good plus if I need to do this for residues in a bunch of proteins/peptides, the task quickly becomes tedious. I would rather write 2 lines of code for the complete protein than write 1 line/residue/protein. Any ideas? Thanks in advance Vamsee

2 1

selection of multiple atoms in a session with multiple pdb structures
by Anindito Sen 09 Sep '12

09 Sep '12

Dear All, I have a Chimera session where 4 different atomic structures (pdb files) are docked in the computed density map of a macromolecular complex. I need to select multiple amino acids positioned at different places of the different docked atomic structures. To explain the situation- Say the 4 docked Atomic structures are A, B, C & D I need to select 276aa of A, 15aa of B, 246aa of C and so on... How can I do that ? Thanks Dr. Anindito Sen (Ph.D) >Department of Cell Biology & Anatomy >Graduate School of Medicine >University of Tokyo >Tel & fax: +81-3-5841-3339

2 1

Distance between two benzene rings
by George Tzotzos 06 Sep '12

06 Sep '12

Hi everybody, I'm trying to work out stacking interactions between two benzene rings. Is there a way to measure the distance from the center of the benzene rings of a Tyr to the center of the benzene ring of a Phe residue? Your help suggestions / help much appreciated as always Regards George

2 1

Fwd: [Chimera] #11323: Chimera using local GLUT installation (was: Chimera bug report submission)
by George Tzotzos 05 Sep '12

05 Sep '12

Apologies for sending this to the List but I haven't received any information regarding the bug report below. Maybe I missed the mail. I have reinstalled Chimera but I get the same error message. Any suggestions how to solve this problem? Many thanks George Begin forwarded message: > From: Chimera <chimera-bugs-admin(a)cgl.ucsf.edu> > Subject: Re: [Chimera] #11323: Chimera using local GLUT installation (was: Chimera bug report submission) > Date: August 27, 2012 7:12:02 PM GMT+02:00 > To: Undisclosed recipients: ; > Reply-To: chimera-bugs(a)cgl.ucsf.edu > > #11323: Chimera using local GLUT installation > ---------------------------------+------------------------------------- > Reporter: gtzotzos@… | Owner: gregc > Type: defect | Status: assigned > Priority: normal | Milestone: Release 1.7 > Component: Platform | Version: 1.6.2 (b36855) > Severity: normal | Resolution: > Keywords: | Blocked By: > Blocking: | Notify when closed: > Platform: Mac OS X (Cocoa 64) | Project: chimera > ---------------------------------+------------------------------------- > Changes (by pett): > > * status: new => assigned > * component: Unassigned => Platform > * project: => chimera > * platform: => Mac OS X (Cocoa 64) > * version: => 1.6.2 (b36855) > * milestone: => Release 1.7 > * owner: pett => gregc > > > -- > Ticket URL: <http://plato.cgl.ucsf.edu/trac/chimera/ticket/11323#comment:1> > Chimera <http://plato.cgl.ucsf.edu/trac/chimera> > Chimera Issue Tracker

1 0

H-bond analysis in case of TIP4P water model ?
by Marek Maly 04 Sep '12

04 Sep '12

Hello, it seem to me that Chimera is not able to do H-bond analysis between water molecules when TIP4P water model is used. Am I right or I overlooked something ? Thank you very much for the answer in advance ! Best wishes, Marek -- Tato zpráva byla vytvořena převratným poštovním klientem Opery: http://www.opera.com/mail/

2 2

Ligand parametrization
by Miro Moman 04 Sep '12

04 Sep '12

Hello, When energy minimising protein-ligand complexes, I have observed that Chimera seldom, if ever, complains about missing parameters. However, when I try to generate a Pmrtop file for the same complexes, quite often sLeap is unable to complete the request due to its inability to recognise certain atom types.. Provided that the minimization engine (MMTK) is using the Amber force filed, I was wondering: Are parameters computed in the same way? If not, what are the differences? Maybe a different forcefield version? In addition, is there a way to inspect the parameters that have been generated for minimising a given ligand or non-standard residue? Kind regards, Miro

2 1

saving spheres
by MARY VARUGHESE 04 Sep '12

04 Sep '12

Hi, I saved the combined sph(two clusters) file. But the file contains two clusters with single ID, so i cant create the box including both clusters, since in the box.in file of dock i can give only one cluster number. How can i assign both clusters into single cluster. or any other suggestion. Thanking You.

2 1

Fwd: Installation problems
by prashant kurkute 04 Sep '12

04 Sep '12

Respected sir, Sorry for making you disturb. I am novice to linux. I am trying to install chimera in ubuntu 12.04 LTS. I follow following instruction. sudo chmod +x chimera-1.6.2-linux_x86_64.bin ./chimera-1.6.2-linux_x86_64.bin (I also triied with root sudo ./chimera-1.6.2-linux_x86_64.bin) I got following reply bash: ./chimera-1.6.2-linux_x86_64.bin: cannot execute binary file Sir please help me to solve problem. I will be greatly thankful to your help. With Best wishes and regards.

2 1

volume of an ensemble
by R. Andrew Byrd 31 Aug '12

31 Aug '12

Dear Chimera Team, Is it possible to get the total volume that encompasses an ensemble of structures? For example, if a docking or structure calculation produces an ensemble of structures, can one calculate the volume that encompasses all the members of the ensemble? A docking calculation may have one component superimposable and the second component represent an ensemble, and it is that ensemble that I would I like a measure of the total volume. Thanks! Andy

2 2

adjust resolution of alignment .eps in Multalign viewer
by Gesa Volkers 30 Aug '12

30 Aug '12

Hi all, I would like to extract a high resolution publication quality image from my alignment from the Multalign viewer. Only option I see is to save it a as .eps, but when I open that file the resolution is not sufficient. Is it possible to get a higher resolution image? Thanks, Gesa

2 2

reasonable minimization times
by David Belnap 30 Aug '12

30 Aug '12

I am trying to link the crystal structure of an Fc domain with two Fab structures. I am using the command "minimize spec sel fragment true" on the command line. When various options come up, I've selected "if alternate locations, keep only highest occupancy", "add hydrogens", "add charges", "consider each model in isolation from all others", "also consider H-bonds", and AMBER ff12SB and ANTECHAMBER to assign charges. I've had jobs run overnight that didn't finish. What is a reasonable time for about 8-10 residues to be minimized? Can you suggest any ways to speed this up? Thanks, David

3 4

problem with loading color scheme in Multalign viewer
by Gesa Volkers 29 Aug '12

29 Aug '12

Hi all, I encountered a problem when I tried to open a color scheme (tried it with custom.par from the Chimera website) in the Multalign viewer. I get the following error: "File "C:\Program Files\Chimera 1.6.2\share\MultAlignViewer\PrefDialog.py", line 69, in addColorScheme self._resColorOpt.set(colorFile) See reply log for Python traceback." I reported a bug. Though has anyone found a way to solve this problem and is able to open a .par file again? Thanks, Gesa

2 2

making a movie problem
by Boskovic.Jasminka 29 Aug '12

29 Aug '12

Hi, I am trying to make a movie with chimera but instead of filming just a molecule's movement the program is making the frames of all the chimera window showing the "File, Select, Actions etc" bottoms and the command line? How can I remove this option and film just the molecule window? Thank you in advance! Best regards, Jasminka Boskovic, PhD Centro Nacional de Investigaciones Oncologicas-CNIO (Spanish National Cancer Research Centre-CNIO) Melchor Fernandez Almagro 3 28029 Madrid Spain Tel.: + (34) 917 328 000 (ext 3031) Fax: + (34) 912 246 980 e-mail: jboskovic(a)cnio.es **NOTA DE CONFIDENCIALIDAD** Este correo electr�nico, y en su caso los ficheros adjuntos, pueden contener informaci�n protegida para el uso exclusivo de su destinatario. Se proh�be la distribuci�n, reproducci�n o cualquier otro tipo de transmisi�n por parte de otra persona que no sea el destinatario. Si usted recibe por error este correo, se ruega comunicarlo al remitente y borrar el mensaje recibido. **CONFIDENTIALITY NOTICE** This email communication and any attachments may contain confidential and privileged information for the sole use of the designated recipient named above. Distribution, reproduction or any other use of this transmission by any party other than the intended recipient is prohibited. If you are not the intended recipient please contact the sender and delete all copies.

2 1

Trivial question
by George Tzotzos 28 Aug '12

28 Aug '12

It seems that a standard feature of Chimera is upon loading a pdb file of a complex, a number of nearby residues also show up. My question is whether there's a rule, let's say a cutoff distance, or other. Thanks in advance for any advice on this Regards George

2 1

Batch energy minimisation
by Miro Moman 24 Aug '12

24 Aug '12

Hello, Searching through the archives, I have found that performing DockPrep in batch mode is quite straightforward: http://mailman.docking.org/pipermail/dock-fans/2007-May/001043.html I have also noticed that, when working from the GUI, energy minimisation involves a previous DockPrep step. I would like to perform the energy minimisation of several protein-ligand complexes, can this be easily done in batch mode? Furthermore, I would also be interested of computing the binding energy both prior and after minimisation (possibly including APBS-computed electrostatic terms...). However, this is of secondary importance as it can be easily achieved with other tools. Best regards, Miro Moman

3 2

graphics problems after update from UCSF-Chimera64-1.5.3 to UCSF-Chimera64-1.6.2
by Dieter Blaas 21 Aug '12

21 Aug '12

Hi, I replaced the previous version of Chimera, UCSF-Chimera64-1.5.3 with the new one UCSF-Chimera64-1.6.2 on our cluster running Linux l22 2.6.32-131.17.1.el6.x86_64 #1 SMP Wed Oct 5 17:19:54 CDT 2011 x86_64 x86_64 x86_64 GNU/Linux whereas everything was perfect so far I now get the error message: X Error of failed request: GLXBadContextTag Major opcode of failed request: 153 (GLX) Minor opcode of failed request: 5 (X_GLXMakeCurrent) Serial number of failed request: 1352 Current serial number in output stream: 1352 followed by a crash. This is annoying since I need the new version for compatibility with some sessions saved with the new version on another machine. Thanks a lot for hints, Dieter -- ------------------------------------------------------------------------ Dieter Blaas, Max F. Perutz Laboratories Medical University of Vienna, Inst. Med. Biochem., Vienna Biocenter (VBC), Dr. Bohr Gasse 9/3, A-1030 Vienna, Austria, Tel: 0043 1 4277 61630, Fax: 0043 1 4277 9616, e-mail: dieter.blaas(a)meduniwien.ac.at ------------------------------------------------------------------------

2 3

a problem with silhouettes
by Alja Oblak 20 Aug '12

20 Aug '12

Dear Chimera users, I am trying to create an image for a publication using Chimera 1.6.1. Whenever I turn on "silhouette" dark spots appear on the screen and on the saved image. They seem totally random but they move along with the structure when rotated. When I zoom on them they look like small "umbrella-shaped" discs. The "show shadows" option is turned off. Does anybody know what are those spots and how to get rid of them? Thank you very much for any help. Regards, Alja Oblak

2 4

how to use antechamber?
by 何永辉 16 Aug '12

16 Aug '12

Hello, Can you show me how to use the ambertool antechamber in Chimera? Thanks! Yonghui Dr. Yonghui He Central South University 932 Lushan South Road Changsha, China.

2 1

em fit refinement
by Bala subramanian 15 Aug '12

15 Aug '12

Friends, I used "fit" command to fit a structure onto a EM map and obtained a list of fits. Now i want to choose the best fit and refine it further. I would like to know if there is any way to refine a fit produced by fit command in Chimera. Or can i use any other software for the same, which can take chimera's fit as input and refine it further. Thanks, Bala -- C. Balasubramanian

3 2

Mountain Lion
by John (Jack) Johnson 13 Aug '12

13 Aug '12

Are there any issues with the current Mac version of Chimera (1.6.2) and Mac OS 10.8 (Mountain Lion)? Also, for a MacBook Pro (latest version) should one be using 32 or 64 bit version of Chimera. Thanks, Jack John E. Johnson Elden R. Strahm Professor of Structural Virology PHONE 858-784-9705 Department of Molecular Biology, MB31 FAX 858-784 -8660 The Scripps Research Institute EMAIL jackj(a)scripps.edu<mailto:jackj@scripps.edu> 10550 N. Torrey Pines Rd. La Jolla, CA 92037 http://johnsonlab.scripps.edu/ Virus Partcle ExploreR (VIPER) http://viperdb.scripps.edu/ ******************************************************************************** Olive Ireland PHONE 858-784-2947 Administrative Assistant EMAIL ireland(a)scripps.edu<mailto:ireland@scripps.edu>

2 1

Elongating TMV capsid
by Jeremiah Gassensmith 13 Aug '12

13 Aug '12

Hello, I've downloaded the tobacco mosaic virus structure from the PDB and used Multiscale Models to build the biological unit. Unfortunately, only about 45 or so of the 2200 protein monomers show up. Is there a way I can multiply the biological unit to elongate the TMV structure? I don't need all 2200 monomers, but something a bit longer would be helpful. Thanks! Jeremiah Dr. Jeremiah J. Gassensmith Stoddart Mechanostereochemistry Group Northwestern University 2145 Sheridan Road Evanston, IL 60208-3113 Phone (W) +1(847)467-5936 Fax +1(847)491-1009

2 1

Chimera inquiry: .py to .u3d conversion
by Will Jones 13 Aug '12

13 Aug '12

Hello, My name is Will. I'm a researcher at the University of Iowa. Our group has been using your Chimera software to visualize a model of our protein of interest. It's been very helpful but I've run into a small issue that I'd like to ask your advice on. I'm trying to convert the 3d image of the saved .py file into a universal 3D file (.u3d). I have tried several types of conversion software including polytrans/nugraph, 3DVIA Composer, and CS5 Adobe Photoshop with no success. Could you please tell me if conversion of .py to .u3d is possible, and if so how I might go about it. Thank you, I appreciate your time. Sincerely, Will -- Department of Biochemistry University of Illinois Urbana-Champaign Class of 2012

3 2

Saving Images
by Hobbs, Merlin Eric 09 Aug '12

09 Aug '12

We are having trouble saving images to look a certain way. More specifically we are trying to make an image with the distance from a residue to a metal ion shown. The problem arises when we save the image the 'thickness' of the distance line doesn't change on the actual saved image. So no matter what the thickness is on chimera the image will always show the distance line as being less thick. Thanks Eric -- Merlin Eric Hobbs | Graduate Student, Biochemistry and Biophysics | Raushel Lab | Rm 2510 | Texas A&M University | College Station, TX 77842 | 979-845-9163 | eric0zero(a)tamu.edu

5 6

Re: [Chimera-users] Rapid Access - a different question/request
by Eric Pettersen 08 Aug '12

08 Aug '12

On Aug 8, 2012, at 2:25 PM, Boaz Shaanan wrote: > OK Eric, thanks. I'll wait for the scroll bar since my window is already stretched to the limit. Okay, there will be a scrollbar in tonight's daily build. Worked fine in my tests. Speak up if it turns out I botched something! --Eric

1 0

Rapid Access - a different question/request
by Boaz Shaanan 08 Aug '12

08 Aug '12

Hi Eric, I actually find the Rapid Access very convenient, however I wonder: is the list limited to the n most recent sessions/pdb ? I actually am missing the option of paging further down the list to jobs that are not in the list but which are quite recent. Is there already an option to do this? The browse button does other things (at list in my hands). Cheers, Boaz Boaz Shaanan, Ph.D. Dept. of Life Sciences Ben-Gurion University of the Negev Beer-Sheva 84105 Israel E-mail: bshaanan(a)bgu.ac.il Phone: 972-8-647-2220 Skype: boaz.shaanan Fax: 972-8-647-2992 or 972-8-646-1710 ________________________________________ From: chimera-users-bounces(a)cgl.ucsf.edu [chimera-users-bounces(a)cgl.ucsf.edu] on behalf of chimera-users-request(a)cgl.ucsf.edu [chimera-users-request(a)cgl.ucsf.edu] Sent: Monday, August 06, 2012 10:00 PM To: chimera-users(a)cgl.ucsf.edu Subject: Chimera-users Digest, Vol 112, Issue 6 Send Chimera-users mailing list submissions to chimera-users(a)cgl.ucsf.edu To subscribe or unsubscribe via the World Wide Web, visit http://plato.cgl.ucsf.edu/mailman/listinfo/chimera-users or, via email, send a message with subject or body 'help' to chimera-users-request(a)cgl.ucsf.edu You can reach the person managing the list at chimera-users-owner(a)cgl.ucsf.edu When replying, please edit your Subject line so it is more specific than "Re: Contents of Chimera-users digest..." Today's Topics: 1. Modelling of missing regions ussing Chimera (Gleb Novicov) 2. (no subject) (Merced Malabanan) 3. Re: Rapid Access file list (Eric Pettersen) ---------------------------------------------------------------------- Message: 1 Date: Sat, 4 Aug 2012 15:44:12 +0400 From: Gleb Novicov <gnovikov87(a)gmail.com> To: chimera-users(a)cgl.ucsf.edu Subject: [Chimera-users] Modelling of missing regions ussing Chimera Message-ID: <CAN=J6WkT9_GH8YYT8U=Nbt-3hhor_YvNHrndwXK6L4ix75uHvA(a)mail.gmail.com> Content-Type: text/plain; charset="iso-8859-1" Dear Chimera's users! I need to model some missing segments ( In particular case I need to build missing N and C termi ) of my protein ussing Modeller's options. Could you tell me about possible solution of that issue ? On my win7 I have installed Chimera as well as Modeller v 9.10 suite. I've defined Modeller pathways in the Chimera's Model pool options but when I've selected option Prune seection to define region of interest I didnt obtain anythinf from both of Chimera or Modeller. On other hand the option Structure -> Modeller tools also not available for me. Does it means that I've installed modeller incorrectly ? Also I've used runmod.dat script with defined variables from which I obtained the below C:\Users\own\Desktop\worktemp>runmod.bat usage: mod9.10 script [...] Doest this means that all work fine ? By the way after executing of that script I could not launch modeller by means of mod9.10.exe from modeller folder. The error from modeller was C:\Program Files\Modeller\bin>mod9.10.exe FATAL ERROR: MODINSTALL9v10 environment variable not set: incomplete MODELLER in stallation Could you explain me whats I've done wrong and how I could fix this problem? Thanks for help Gleb

2 1

Modelling of missing regions ussing Chimera
by Gleb Novicov 08 Aug '12

08 Aug '12

Dear Chimera's users! I need to model some missing segments ( In particular case I need to build missing N and C termi ) of my protein ussing Modeller's options. Could you tell me about possible solution of that issue ? On my win7 I have installed Chimera as well as Modeller v 9.10 suite. I've defined Modeller pathways in the Chimera's Model pool options but when I've selected option Prune seection to define region of interest I didnt obtain anythinf from both of Chimera or Modeller. On other hand the option Structure -> Modeller tools also not available for me. Does it means that I've installed modeller incorrectly ? Also I've used runmod.dat script with defined variables from which I obtained the below C:\Users\own\Desktop\worktemp>runmod.bat usage: mod9.10 script [...] Doest this means that all work fine ? By the way after executing of that script I could not launch modeller by means of mod9.10.exe from modeller folder. The error from modeller was C:\Program Files\Modeller\bin>mod9.10.exe FATAL ERROR: MODINSTALL9v10 environment variable not set: incomplete MODELLER in stallation Could you explain me whats I've done wrong and how I could fix this problem? Thanks for help Gleb

4 5

Re: [Chimera-users] Chimera-users Digest, Vol 112, Issue 2
by vamsee 07 Aug '12

07 Aug '12

Hello, I am trying to script distance measurements (distance monitor) between the Calpha of a residue and a few Hydrogens. I have pretty much everything working except that I am not able to figure out how to change the attributes (color, line style etc..) of the distances (pseudo-bonds). I know it can be changed using the GUI but I would rather script it. Any suggestions? Thank you Vamsee On Thu, Aug 2, 2012 at 1:00 PM, <chimera-users-request(a)cgl.ucsf.edu> wrote: > Send Chimera-users mailing list submissions to > chimera-users(a)cgl.ucsf.edu > > To subscribe or unsubscribe via the World Wide Web, visit > http://plato.cgl.ucsf.edu/mailman/listinfo/chimera-users > or, via email, send a message with subject or body 'help' to > chimera-users-request(a)cgl.ucsf.edu > > You can reach the person managing the list at > chimera-users-owner(a)cgl.ucsf.edu > > When replying, please edit your Subject line so it is more specific > than "Re: Contents of Chimera-users digest..." > > > Today's Topics: > > 1. combining mrc maps (Daniel Murin) > 2. Re: combining mrc maps (Elaine Meng) > 3. Re: combining mrc maps (Tom Goddard) > 4. double bonds visualization ? (Marek Maly) > > > ---------------------------------------------------------------------- > > Message: 1 > Date: Wed, 1 Aug 2012 18:58:53 -0700 > From: Daniel Murin <cmurin(a)scripps.edu> > To: "chimera-users(a)cgl.ucsf.edu" <chimera-users(a)cgl.ucsf.edu> > Subject: [Chimera-users] combining mrc maps > Message-ID: > < > 83025BE3F3B8D644AA9F8CAA21F2640801A3D700C402(a)EXCH-CCR01.lj.ad.scripps.edu> > > Content-Type: text/plain; charset="us-ascii" > > Hi, > > I was wondering if it is possible to combine two mrc volumes into a single > volume and save that as a new mrc file? I haven't really been able to find > anything and I suspect that this may not be possible with Chimera. > > Thank you for your help, > > Daniel > > > > Charles Daniel Murin > Graduate Student - Ward/Ollmann-Saphire Labs > Department of Molecular Biology > Kellogg School of Science and Technology > The Scripps Research Institute > 10550 North Torrey Pines Road, CB 227 > La Jolla, CA 92037 > > Work: 858.784.9053 > Fax: 858.784.8218 > email: cmurin(a)scripps.edu > > > > ------------------------------ > > Message: 2 > Date: Thu, 2 Aug 2012 10:06:36 -0700 > From: Elaine Meng <meng(a)cgl.ucsf.edu> > To: Daniel Murin <cmurin(a)scripps.edu> > Cc: "chimera-users(a)cgl.ucsf.edu" <chimera-users(a)cgl.ucsf.edu> > Subject: Re: [Chimera-users] combining mrc maps > Message-ID: <20D05B2F-142C-4433-B4A3-A8BAB0242919(a)cgl.ucsf.edu> > Content-Type: text/plain; charset=us-ascii > > Hi Daniel, > You can add or subtract maps to make a new map using the "vop" command: > > <http://www.cgl.ucsf.edu/chimera/docs/UsersGuide/midas/vop.html> > > That command has various other filtering and scaling options that may also > be of interest. You can save the new map to a file using the Volume Viewer > dialog (its File menu) or the "volume" command. > > I hope this helps, > Elaine > ---------- > Elaine C. Meng, Ph.D. > UCSF Computer Graphics Lab (Chimera team) and Babbitt Lab > Department of Pharmaceutical Chemistry > University of California, San Francisco > > On Aug 1, 2012, at 6:58 PM, Daniel Murin wrote: > > > Hi, > > I was wondering if it is possible to combine two mrc volumes into a > single volume and save that as a new mrc file? I haven't really been able > to find anything and I suspect that this may not be possible with Chimera. > > Thank you for your help, > > Daniel > > > > > ------------------------------ > > Message: 3 > Date: Thu, 02 Aug 2012 10:07:18 -0700 > From: Tom Goddard <goddard(a)sonic.net> > To: Daniel Murin <cmurin(a)scripps.edu> > Cc: "chimera-users(a)cgl.ucsf.edu" <chimera-users(a)cgl.ucsf.edu> > Subject: Re: [Chimera-users] combining mrc maps > Message-ID: <501AB3C6.2050900(a)sonic.net> > Content-Type: text/plain; charset=ISO-8859-1; format=flowed > > Hi Daniel, > > Yes, just add the two map with the volume operation command > > vop add #1,2 > > This will extend the grid of map #1 to cover map #2 then interpolate map > #2 on that grid and add it. You may also want to scale the values of > one map so that the two maps have comparable density ranges using the > "scaleFactors" option. > > http://www.cgl.ucsf.edu/chimera/current/docs/UsersGuide/midas/vop.html#add > > Tom > > > > Hi, > > > > I was wondering if it is possible to combine two mrc volumes into a > single volume and save that as a new mrc file? I haven't really been able > to find anything and I suspect that this may not be possible with Chimera. > > > > Thank you for your help, > > > > Daniel > > > > > > > > Charles Daniel Murin > > Graduate Student - Ward/Ollmann-Saphire Labs > > Department of Molecular Biology > > Kellogg School of Science and Technology > > The Scripps Research Institute > > 10550 North Torrey Pines Road, CB 227 > > La Jolla, CA 92037 > > > > > > ------------------------------ > > Message: 4 > Date: Thu, 02 Aug 2012 20:00:51 +0200 > From: "Marek Maly" <marek.maly(a)ujep.cz> > To: chimera-users(a)cgl.ucsf.edu > Subject: [Chimera-users] double bonds visualization ? > Message-ID: <op.wifdnpi4lc8gdf(a)pocitadlon.ujep.cz> > Content-Type: text/plain; charset=iso-8859-2; format=flowed; delsp=yes > > Hello, > > I am just curious if it is possible to visualize double bonds > as double bonds now similarly like in case of rings one > can visualize them nicely (aromatic ring/disc). > > Thanks for the info in advance, > > Best wishes, > > Marek > > > -- > Tato zpr?va byla vytvo?ena p?evratn?m po?tovn?m klientem Opery: > http://www.opera.com/mail/ > > > ------------------------------ > > _______________________________________________ > Chimera-users mailing list > Chimera-users(a)cgl.ucsf.edu > http://plato.cgl.ucsf.edu/mailman/listinfo/chimera-users > > > End of Chimera-users Digest, Vol 112, Issue 2 > ********************************************* >

2 2

(no subject)
by Merced Malabanan 06 Aug '12

06 Aug '12

Hi, I'm trying to get used to the new Rapid Access interface of chimera. But how do you remove the list (or items on the list) on the right side of the interface? Thanks.

2 1

SASA vs. MSA
by Nikolay Igorovich Rodionov 05 Aug '12

05 Aug '12

Hi all, I was wondering if you could help me conceptualize what is going on in this situation. I ran both solvent accessible surface area and solvent excluded (molecular) surface area calculations. When I compared the output for both of these calculations I found that, overall, atoms that contribute to the SASA are buried 1-3 angstroms deeper in the protein than those that contribute to the MSA. I don't really understand how this could be unless the deeper buried SASA atoms have a much larger van der waals radii than MSA atoms (I get that some atoms contribute to both). Thanks!

2 6

trajectory rmsd
by George Tzotzos 03 Aug '12

03 Aug '12

I'm writing to find out if it is possible to determine the rmsd of specific residues, say 20-120 (backbone atoms only) from a trajectory against the corresponding residues of an X-ray structures. I used the Movie tool to load the trajectory having loaded prior to it the reference structure. I couldn't find a way to compute what I described above. Your help as always is much appreciated Best regards George

2 1

Inifinite lattice minimisation
by Kyle Morris 03 Aug '12

03 Aug '12

Dear all, I am trying to do minimisations on a crystal system. I wonder if when chimera knows the unit cell will it minimise as an infinite lattice or do the copies need to be explicitly created before minimisation proceeds? Really appreciate any help/insight. Best wishes, Kyle

2 2

combining mrc maps
by Daniel Murin 02 Aug '12

02 Aug '12

Hi, I was wondering if it is possible to combine two mrc volumes into a single volume and save that as a new mrc file? I haven't really been able to find anything and I suspect that this may not be possible with Chimera. Thank you for your help, Daniel Charles Daniel Murin Graduate Student - Ward/Ollmann-Saphire Labs Department of Molecular Biology Kellogg School of Science and Technology The Scripps Research Institute 10550 North Torrey Pines Road, CB 227 La Jolla, CA 92037 Work: 858.784.9053 Fax: 858.784.8218 email: cmurin(a)scripps.edu

3 3

double bonds visualization ?
by Marek Maly 02 Aug '12

02 Aug '12

Hello, I am just curious if it is possible to visualize double bonds as double bonds now similarly like in case of rings one can visualize them nicely (aromatic ring/disc). Thanks for the info in advance, Best wishes, Marek -- Tato zpráva byla vytvořena převratným poštovním klientem Opery: http://www.opera.com/mail/

2 2

Re: [Chimera-users] FW: FW: problem in visualising metal- atoms in simulated
by Mahendra B Thapa 31 Jul '12

31 Jul '12

Dear Dr. Elaine, May I send my pdb file? I could not fix the problems; I tried my best as far as I can , with possible alternatives. Thanks, Mahendra Thapa University of Cincinnati On Mon, Jul 30, 2012 at 12:58 PM, Thapa, Mahendra (thapamb) < thapamb(a)mail.uc.edu> wrote: > > > > ________________________________________ > From: Elaine Meng > Sent: Monday, July 30, 2012 10:58:32 AM (UTC-06:00) Central America > To: Thapa, Mahendra (thapamb) > Cc: chimera-users(a)cgl.ucsf.edu > Subject: Re: [Chimera-users] FW: problem in visualising metal- atoms in > simulated > > The atom names of the ions should not be lined up with the other names, > and the last field should be CA not C. So there are at least two problems > with these lines. Please see the format description in the link in my > previous message. > > Some additional problems are that the ion lines should probably be HETATM > not ATOM, and the names CA not CO. So I would fix those things too. > Best, > Elaine > > On Jul 30, 2012, at 9:46 AM, Mahendra B Thapa wrote: > > > Dear Dr. Elaine, > > > > The last few lines of the file are as follows: > > ATOM 1212 OXT GLN 76 17.333 31.515 17.211 1.00 0.00 > O > > TER > > ATOM 1213 CO CAL 77 35.029 27.971 38.126 1.00 0.00 > C > > TER > > ATOM 1214 CO CAL 78 37.868 20.307 30.270 1.00 0.00 > C > > TER > > > > I also tried with Ca instead of C in the last column , but no > improvement. > > > > Thank you for help, > > Mahendra Thapa > > University of Cincinnati > > > > > > On Mon, Jul 30, 2012 at 12:34 PM, Thapa, Mahendra (thapamb) < > thapamb(a)mail.uc.edu> wrote: > > > > > > > > ________________________________________ > > From: Elaine Meng > > Sent: Monday, July 30, 2012 10:34:51 AM (UTC-06:00) Central America > > To: Thapa, Mahendra (thapamb) > > Cc: chimera-users(a)cgl.ucsf.edu > > Subject: Re: [Chimera-users] problem in visualising metal- atoms in > simulated > > > > Hi Mahendra, > > Probably the format is slightly wrong for the lines with the calcium ion > coordinates. For example, the name CA for the calcium ion should *not* line > up with the name CA in the protein alpha-carbon lines. > > > > In the ATOM and HETATM lines of PDB files, > > < > http://www.cgl.ucsf.edu/chimera/docs/UsersGuide/tutorials/pdbintro.html#coo… > > > > > > ...the ion name CA should be in columns 13-14, whereas the alpha-carbon > name CA should be in columns 14-15. > > > > Misalignment of ion names is a common problem with the output of many > programs. > > < > http://www.cgl.ucsf.edu/chimera/docs/UsersGuide/tutorials/pdbintro.html#mis… > > > > > > Best, > > Elaine > > ---------- > > Elaine C. Meng, Ph.D. > > UCSF Computer Graphics Lab (Chimera team) and Babbitt Lab > > Department of Pharmaceutical Chemistry > > University of California, San Francisco > > > > On Jul 30, 2012, at 9:21 AM, Mahendra B Thapa wrote: > > > > > Dear Chimera Users, > > > I converted amber-12 generated rst-file in netCDF format [ > test_equil.rst ] to the pdb format [ test_equil_rst.pdb] by using the > cpptraj command of amber 12. When I loaded it in chimera, the protein > structure looks fine but two calcium atoms that the protein binds could > not be visualised, although the pdb file-format looks good. > > > Let me help in this respect. > > > > > > > > > > _______________________________________________ > > Chimera-users mailing list > > Chimera-users(a)cgl.ucsf.edu > > http://plato.cgl.ucsf.edu/mailman/listinfo/chimera-users > > > >

2 1

Unable to visualize density maps
by Anindito Sen 30 Jul '12

30 Jul '12

Dear All, With the latest Chimera version in Daily Build for Mac , I am unable to visualize any density map in the "surface" and the "mesh" mode. On playing around trying to visualize the density maps I get something like the following attached figure. However I can see the maps at the "solid" mode. I am using Snow Leopard 10.6.8. Best Andy Versions Not Working: Mac OS X chimera-alpha-mac.dmg Size: 105982078 bytes MD5: ba098e1169a7fb37f9b80bbac27cae26 Jul 28, 2012 Mac OS X 64-bit chimera-alpha-mac64.dmg Size: 93344817 bytes MD5: 22700ce0b2b0272d3efe060832933ee5 Jul 28, 2012 Dr. Anindito Sen (Ph.D) >Department of Cell Biology & Anatomy >Graduate School of Medicine >University of Tokyo >Tel & fax: +81-3-5841-3339

2 1

ff dat file
by Nikolay Igorovich Rodionov 30 Jul '12

30 Jul '12

Hi, since I am able to implement various force fields, does that mean that I have the .dat files of those ff buried somewhere in my chimera directory? I want to add my custom ff parameters to PDB2PQR so I need to locate the .dat files of force fields like Amber12 and Amber99SB. Thank you, Nikolay Rodionov

3 2

Re: [Chimera-users] FW: problem in visualising metal- atoms in simulated
by Mahendra B Thapa 30 Jul '12

30 Jul '12

Dear Dr. Elaine, The last few lines of the file are as follows: ATOM 1212 OXT GLN 76 17.333 31.515 17.211 1.00 0.00 O TER ATOM 1213 CO CAL 77 35.029 27.971 38.126 1.00 0.00 C TER ATOM 1214 CO CAL 78 37.868 20.307 30.270 1.00 0.00 C TER I also tried with Ca instead of C in the last column , but no improvement. Thank you for help, Mahendra Thapa University of Cincinnati On Mon, Jul 30, 2012 at 12:34 PM, Thapa, Mahendra (thapamb) < thapamb(a)mail.uc.edu> wrote: > > > > ________________________________________ > From: Elaine Meng > Sent: Monday, July 30, 2012 10:34:51 AM (UTC-06:00) Central America > To: Thapa, Mahendra (thapamb) > Cc: chimera-users(a)cgl.ucsf.edu > Subject: Re: [Chimera-users] problem in visualising metal- atoms in > simulated > > Hi Mahendra, > Probably the format is slightly wrong for the lines with the calcium ion > coordinates. For example, the name CA for the calcium ion should *not* line > up with the name CA in the protein alpha-carbon lines. > > In the ATOM and HETATM lines of PDB files, > < > http://www.cgl.ucsf.edu/chimera/docs/UsersGuide/tutorials/pdbintro.html#coo… > > > > ...the ion name CA should be in columns 13-14, whereas the alpha-carbon > name CA should be in columns 14-15. > > Misalignment of ion names is a common problem with the output of many > programs. > < > http://www.cgl.ucsf.edu/chimera/docs/UsersGuide/tutorials/pdbintro.html#mis… > > > > Best, > Elaine > ---------- > Elaine C. Meng, Ph.D. > UCSF Computer Graphics Lab (Chimera team) and Babbitt Lab > Department of Pharmaceutical Chemistry > University of California, San Francisco > > On Jul 30, 2012, at 9:21 AM, Mahendra B Thapa wrote: > > > Dear Chimera Users, > > I converted amber-12 generated rst-file in netCDF format [ > test_equil.rst ] to the pdb format [ test_equil_rst.pdb] by using the > cpptraj command of amber 12. When I loaded it in chimera, the protein > structure looks fine but two calcium atoms that the protein binds could > not be visualised, although the pdb file-format looks good. > > Let me help in this respect. > > > >

2 1

problem in visualising metal- atoms in simulated
by Mahendra B Thapa 30 Jul '12

30 Jul '12

Dear Chimera Users, I converted amber-12 generated rst-file in *netCDF format* [ test_equil.rst ] to the pdb format [ test_equil_rst.pdb] by using the cpptraj command of amber 12. When I loaded it in chimera, the protein structure looks fine but two calcium atoms that the protein binds could not be visualised, although the pdb file-format looks good. Let me help in this respect. Thanks, Mahendra Thapa University of Cincinnati

2 1

Coulombic Potential Dielectric
by Nikolay Igorovich Rodionov 26 Jul '12

26 Jul '12

Hi, I just have a question about the default dielectric coefficient in the Coulombic surface coloring function. Does the coefficient of 4 correspond to the dielectric of the solvent or the solute (the biomolecule)? I think the latter makes more sense but I just want to make sure. Thanks! Nikolay Rodionov

2 2

Pot.dx to cartesian
by Nikolay Igorovich Rodionov 26 Jul '12

26 Jul '12

Hi all, I was wondering if anyone knows of a program that can take the gridpoint potential matrix from the APBS output pot.dx file and convert it into Cartesian coordinates. Something like: X Y Z Potential 545 5 54 +2.5484 Thanks! Nikolay Rodionov

1 0

how do I open RMF files in chimera on Mac?
by Khuri, Natalia 26 Jul '12

26 Jul '12

Natalia Khuri PhD Student, Graduate Group in Biophysics Laboratory of Andrej Sali UCSF MC 2552 Byers Hall Room 503B 1700 4th Street San Francisco, CA 94158-2330, USA

2 1

Doubt regarding cryeom map density threshold setting
by rakesh ramachandram 24 Jul '12

24 Jul '12

Hello, My name is Rakesh. I would like to know how to set the density threshold according to the molecular mass of the protein in the cryoem map. I would also like to know how to calculate the molecular mass of a particular segment after segmentation in cryoem map. Regards Rakesh Ramachandran PhD Student Molecular Biophysics Unit, Indian Institute of Science, Bangalore - 560012 India

2 5

thioester linkage between two protein
by Hamze Rahimi 24 Jul '12

24 Jul '12

Dear Expert I want defiend a thioester linkage between the C-terminal carboxyl group of G and the sulfhydral group of cysteine in the middle of other protein. Please let me know if there is such possibility in Chimera Best wish -- Hamzeh Rahimi PhD student in Medical Biotechnology INT-KIT,Karlsruhe

2 1

Radial color solid style map display
by Tom Goddard 23 Jul '12

23 Jul '12

Hi David, Radially coloring using solid style map display doesn't work. Solid style display of a single plane with volume viewer uses a gray-level coloring of the plane. The Surface Color tool and other coloring tools in Chimera replace the coloring of a surface and aren't able to modulate the existing (gray-level) coloring. But there are often tricky ways to get what you want. I've attached a picture of a radial color of a plane of an HIV tomogram. I did it by opening the map twice. With the first copy I display the solid style plane. With the second copy I display one plane in surface style with a low contour level. Then I placed a marker (volume tracer) at the center of a virus on that surface and used surface color to color that surface radially (scolor command). Then I made that surface transparent (command "transp 90 #1" in Chimera daily build). It didn't look good because the two planes were coincident which created artifacts, so I froze the first map (Model Panel, deactivate) and moved the second one a tiny bit in front. Also I made the background color gray -- black or white give somewhat different appearance. You could also layer a transparent radial colored layer on top in PhotoShop or Gimp I bet. Tom > Hi Tom, > I'm writing as I would like to color by radius an EM map but when it is displayed as a single plane of width=1 pixel. > Is this possible? > Thanks a lot > David > > David Veesler > Research Associate > The structural Virology lab - Johnson's lab > Department of Molecular Biology > The Scripps Research Institute > > >

1 0

CHIMERA clarification / mis-alignment?
by Anand K S Rao 20 Jul '12

20 Jul '12

Greetings to all CHIMERA Forum members / users / bug-fixers I am PhD student working on trying to identify F-box domains in plant proteomes, primarily via sequence based approaches like HMM profile based discovery. In order to build the profile HMM, I am building my seed alignment with the use of a structural alignment of solved crystal structures of human F-box proteins. Specifically, I seek some help from you or any of your lab members regarding what might possibly be a bug in your CHIMERA, and also help with protocol / parameter choice for both Matchmaker and Match->Align work I am doing. The PDBs trimmed to just the domain regions of my interest are attached as zipped folder #1. When I use default parameters for Matchmaker followed by default parameters for Match->Align, I obtain a multiple sequence alignment that appears well conserved except at the N and C terminals (based on RMSD track in the output EPS file) - However, for 2E31-A, the LW di-peptide (in the 2nd row of the alignment) is matched with the rest of the multipel sequence alignment. Please see attachment #2 - this mismatch in the MSA, is actually a structural match as seen via CHIMERA and PyMOL. So my *question #1* is how can I be sure that other residues have been accurately aligned in 3D and then accurately aligned in the 2D MSA? If this even an artifact, is it caused more by some error in my choice of methods / parameters or is this indeed a mis-alignment that should be all alignment LW at those two positions? (which is how it looked even in PyMol after structural superposition) And my *question #2* is what are the most appropriate parameters to be used for the purposes for my Match -> Align work? Should I use iteration for Matchmaker or not, if so how many or until convergence, if yes or otherwise, what should the residue RMSD not exceed? Should I retain it as the default 5A or do down to a conservative 1A instead? Thanks for any help in this regard. Sincerely, Anand -- Anand K.S. Rao PhD candidate Plant Biology Graduate Group President Indian Graduate Student Association @ UCDavis University of California at Davis Davis, CA - 95616 USA -------------------------------------------- CTTATTGTTGAACTTOAATGGTGCTAATGATCCTCGTOTCTCCTGAACGT (translate THAT!) -- Anand K.S. Rao PhD candidate Plant Biology Graduate Group President Indian Graduate Student Association @ UCDavis University of California at Davis Davis, CA - 95616 USA -------------------------------------------- CTTATTGTTGAACTTOAATGGTGCTAATGATCCTCGTOTCTCCTGAACGT (translate THAT!) -- Anand K.S. Rao PhD candidate Plant Biology Graduate Group President Indian Graduate Student Association @ UCDavis University of California at Davis Davis, CA - 95616 USA -------------------------------------------- CTTATTGTTGAACTTOAATGGTGCTAATGATCCTCGTOTCTCCTGAACGT (translate THAT!)

2 1

Box-beam protein sculptures
by Tom Goddard 18 Jul '12

18 Jul '12

Hi Dan, I added the "shape boxpath" command to Chimera to display box-beam protein backbones and output cut distances for making your physical models. http://collegenews.org/faculty-focus/2011/welding-art-and-science.html I've attached an example picture and command script that made that picture. More details, for example, how to get the cut distances is given in the Chimera feature/bug database: http://plato.cgl.ucsf.edu/trac/chimera/ticket/11191#comment:1 I have not tested the output cut distances so you should do some sanity checks with simple test cases before you trust those numbers. If you are curious about the code it is here http://plato.cgl.ucsf.edu/trac/chimera/browser/trunk/libs/Shape/boxpath.py The new command will be in tonight's Chimera daily builds. Here's a weird connection. These sculptural box beams may help display large molecules on cell phones! Cell phones have slow 3-d graphics and this square cross-section depiction would place minimal computational demands on the phone. Typical depictions with spheres and cylinders and smooth ribbons require a lot more computational power. Tom -------- Original Message -------- Subject: Re: Fwd: [Chimera-users] Texans: get to work! From: Daniel Gurnon To: Tom Goddard Date: 7/17/12 3:26 PM > Hi Tom, > Sorry for the delay- I was just about to email you when I discovered > your message. Missed it the first time somehow. Thanks for offering to > help. > > The key to the saw problem is doing it old-school: Julian > Voss-Andreae (the artist who came up with the idea of turning protein > backbones into miter-cut sculptures) showed me how to use a Japanese > pull-saw to make the cuts by hand. Besides being easier than setting > up a miter saw, the small kerf minimizes material loss. The distances > along the edges allow us to trace out the plane, and then you just > carefully cut along the line. > > When we did this in steel we used grinders to cut out each piece from > a box beam. It was a little more difficult than it was with wood, > because to make the welds look right we had to account for the > thickness of the material. > > And about the Euler angles- right, there would only be two in this > case. The third is what allows us to translate the 3D structure back > into a linear piece of material. As long as the material is > symmetrical, you can make the miter cuts and just flip every other piece. > > So as I mentioned in my earlier message, Julian's C++ program does > this but isn't user friendly. We want to make one that is > user-friendly so that others can try the same thing (would make a > great art/science lab!), and I want to integrate it with Chimera. I'm > attaching his program to this email so you can see what its doing. > Again, thanks a lot for the help! > Dan > > > On Thu, Jul 12, 2012 at 12:52 AM, Tom Goddardwrote: > > Hi Dan, > > The method I described could easily dump out the distances along > the 4 box edges where the cuts cross. From those numbers I could > mark a beam. But how to make an angled cut depends on what kind > of saw you are using. Using a wood radial arm type miter saw I > think you can usually adjust the blade rotation about the vertical > axis, but not about any other axis. Maybe some can be tilted > about the horizontal front back axis too. In any case your saw or > cutting machine needs to have two degrees of freedom to make the > cut any plane through a box shaped beam. There are lots of > differing conventions for Euler angles so if your saw used Euler > angles it would be necessary to know the exact convention and > reference frame. There are 3 Euler angles and this problem only > involves two angles. In summary, any quantitative description of > the cuts could be output relatively easily, the hard part is > providing a precise specification that defines those output > values. I think it looks cool and am happy to take a crack at the > Python code if I know exactly what is needed. > > Tom > > > >> A method of computing a surface model like you describe would be >> great Tom. Thanks. During the planning stages for the sculptures >> I just played with bond thickness until I had something that >> looked close to what we were making (see attached figure, c and >> d). A true boxed backbone would be better. Also, a script and >> explanation like yours would be useful for teaching, as another >> little example of useful intersections between computer science, >> math, biochemistry and art. >> >> But the other aim I have is to use Chimera to obtain the >> distances from point to point along the four edges of a real beam >> of some specified thickness (and with a specified distance from >> alpha carbon to alpha carbon). Marking and connecting these >> points would result in a series of planes for making miter-cuts. >> If the material is symmetrical, a linear beam can be transformed >> into a 3D backbone by cutting at these planes and then inverting >> every other segment (see attached figure, a and b). That's where >> the Euler angles come in. >> Dan >> >> On Wed, Jul 11, 2012 at 7:25 PM, Tom Goddard wrote: >> >> Hi Dan, >> >> If your aim is to draw the box beam protein backbone one >> way to go about it is as follows. Make the 4 paths that >> follow the box corners and traverse one end of the protein to >> the other. How to do this. Start at one end and place a >> square (the box beam cross-section) with center at the first >> backbone atom and with its plane perpendicular to the line >> between atom 1 and atom 2. Then draw lines starting from >> each corner of the square parallel to the line between atoms >> 1 and 2. To decide where these lines have to turn at atom 2 >> create a plane that passes through atom 2 and is >> perpendicular to the plane defined by atoms 1, 2, and 3 and >> bisects the angle formed by segments 1/2 and 2/3. The lines >> from 1 to 2 bend when they hit that plane and new lines head >> off parallel to the line between atoms 2 and 3. Now repeat >> the process to find where those lines bend on the bisecting >> plane through atom 3. Once you have the 4 lines with all >> their bend points you can draw a quadrilateral for each box >> face using the 4 appropriate line bend points. In this >> prescription the rotational orientation of the square placed >> at the start is arbitrary. Different rotations will give >> different appearances. The calculation would be very fast >> and the whole box path could be updated in real time as you >> rotated the end and that causes rotation of all the other box >> beam segments. >> >> The analytic geometry to do this calculation and make the >> surface model in Chimera is not too hard and I could give you >> a bit of Python code to do it and display in Chimera if you like. >> >> Tom >> >> >> >>> Dan, >>> Tom Goddard is our "Euler angle expert", so I'm forwarding >>> this along! >>> >>> --Eric >>> >>> Begin forwarded message: >>> >>>> *From: *Daniel Gurnon >>>> *Date: *July 11, 2012 2:25:36 PM PDT >>>> *To: *Eric Pettersen >>>> *Subject: **Re: [Chimera-users] Texans: get to work!* >>>> >>>>> >>>> I guess I'm baffled by the question. :-) The >>>> difference in coordinates for two atoms is a >>>> translation vector. What does the "rotation matrix for >>>> two atoms" mean exactly? >>>> >>>> --Eric >>>> >>>> >>>> I didn't explain that very well at all. Bear with me here, >>>> because I haven't had a math class in almost 20 years.... >>>> >>>> Say a protein is displayed as a backbone trace, from alpha >>>> carbon to alpha carbon. So, aC1 and aC2 make a line. I want >>>> to know how to get from aC2 to aC3 by way of Euler angles, >>>> and then how to get to aC4 relative to the line between >>>> aC2-C3, and on and on down the line. In other words, these >>>> angles would allow me to take all of the coordinates of the >>>> 3D structure and translate them into a straight line...or >>>> more importantly, to take a straight line of atoms and >>>> transform it into a 3D structure. >>>> >>>> The artist I worked with on the protein sculptures, Julian >>>> Voss Andreae, basically used this approach to turn the >>>> coordinates from a pdb file into cutting instructions for >>>> the steel. When we made the sculptures, I used chimera to >>>> render proteins similar to how they would appear as final, >>>> welded sculptures. When we decided on our "subjects", I >>>> gave Julian the coordinates and he used his program to >>>> create the instructions. He wrote a program of his own to >>>> do this, but it requires programming knowledge to use it. >>>> My goal is to make a user-friendly version for students, >>>> and I want to integrate it with chimera to take advantage >>>> of all of the built-in display options. >>> >>

1 0

Re: [Chimera-users] Chimera Surface Calculation
by Tom Goddard 18 Jul '12

18 Jul '12

Hi Robert, Unfortunately the MSMS molecular surface calculation code has bugs and so it fails to compute surfaces for most large (>10,000 atom) PDB models. The surface calculation has essentially no chance of working with a model of 110,000 atoms such as your half-virus. That said I used the 64-bit Mac Chimera and split the model by chains and it surfaced fine -- see attached image. The Windows Chimera versions have the most surface calculation failures especially 64-bit Windows Chimera, and Mac and Linux are substantially better. So I made the image bmv.jpg with "split #0; surf; rainbow model". After the split, it is odd that many of the subunits have no atoms shown. I used Actions / Atoms / Show to show them. If you don't require a solvent excluded surface (rolling a ball over the atoms to get the surface), you can use a Gaussian surface. The second image bmv5.jpg was made without splitting the model using a 5 Angstrom density map. molmap #0 5 model #1 volume #1 step 1 color lightblue :.A color lightyellow :.B color pink :.C color red :.D-K scolor #1 zone #0 range 10 Tom > Hi Tom, > I am a post doc at Indiana University in the Biochemistry department, and I was at the chimera tutorial you gave to our department through David Morgan. I wasn't sure who to write with this question, so I thought I would start with you but if this is more appropriate for someone else, just let me know. > > Forever ago I used Viper to create a 60 subunit (or 1/2) capsid for BMV, and made several models for publications. That .pdb file that I made no longer works within Chimera, and I have literally tried everything to get it to work. Additionally, it seems Viper no longer lets you make those .pdb files anymore. I have tried changing the atomic radii probe radius, the vertex density, set the disjoint surfaces to false, and every combination of those things. Additionally, when I use the split command, it either only shows a weird surface or no surface at all, and almost completely obliterates the original structure. If you know another way to do this, I would really appreciate any advice here as I have spent hours reading through forums. I attached the .pdb to this email. Again I really appreciate your help. > > Thanks in advance, > Robert > >

4 3

Stick and Ribbon Connection
by Ardian Soca Wibowo 17 Jul '12

17 Jul '12

Hello, I have modeled a structure where a portion is model as sticks while an adjacent portion is a ribbon. The space between the two representation is disconnected. In the overall view of the figure, this broken space is an eyesore, thus I would like to know a way/command that will connect the disconnected portion between the stick and ribbon representations. Thanks in advanced for the help. Ardian -- Ardian Soca Wibowo, Ph.D. Postdoctoral Associate Dann Research Group Department of Chemistry Indiana University Simon Hall Rm. 309 812-856-3216 awibowo(a)indiana.edu

2 3

Trouble with display options
by vamsee 17 Jul '12

17 Jul '12

Hi, I am Vamseedhar Rayaprolu (Vamsee). I work with viruses and I am trying to generate a movie using only a script and NO GUI. I use a viral protein from the VIPERdb and hence it automatically generates a multimer (capsid) for me. The underlying question is 2-fold. The model generated from a vdb file is a pseudo-model and doesn't carry any co-ordinates for each of the subunits. Therefore the whole model is numbered #modelnumber (#1 in this case). The capsid has 60 subunits and when I mouse-over onto each of the subunits, it shows me the model number and the sub-model number but when I try to access the sub models through the command line, it selects #1 as a whole and not the sub-model. I need to be able to select each sub-model through the command line. Any ideas on this? Next, I need to be able to show each sub-model in a ribbon form. Trying to show the whole model (#1) in the ribbon form using a command doesn't work. It works when done from the GUI though. I know if I can split the above multimer into sub-models I should be able to use the ribbon command and get what I need. But the split command doesn't work on the model as there are not atomic co-ordinates (pseudo-model). Any suggestions on this? Thank you -Vamsee

3 2

Re: [Chimera-users] Programming within Chimera
by Mario Dejung 12 Jul '12

12 Jul '12

Thanks Conrad, I really must have been blind, didn't found the IDLE window. I also leave the "open file window" open, makes it much easier, but to figure out which variables are set and how a list of open model looks like etc, it makes it much easier to use idle :-) Thanks a lot!

1 0

Texans: get to work!
by Eric Pettersen 11 Jul '12

11 Jul '12

Anybody made a Chimera image bigger than this one? Biology mural at James Madison University on the Behance Network (okay, okay, Chimera-assisted image — I think it counts!) --Eric

2 1

Question on volume viewer
by kirtana S 11 Jul '12

11 Jul '12

Dear Users, I did the steps as Action > Surface > show as solid and then measure volume . Can you tell me what are units of these values is. this in Angstroms^3 or nm^3 Kirti

2 1

Motion of an atom
by Raju Purohit 11 Jul '12

11 Jul '12

Hello friends, I need some help here. I created a basic model having just an atom and set its coordinates as (0,0,0). Now I want to make it move along a certain path defined mathematically (say, along x axis) and I need to see it move. So I used a * for* loop. But I couldn't see and motion and soon realised that the loop is very quick in executing and thus I could see the atom at its last coordinates. So I tried to add delay of 0.5 seconds for each loop by importing *time* module and useing *time.sleep*. But still I couldn't see any motion and the coordinates of the atom is set only at the end of the *for* loop. I could not see the intermediate path. I am sure you people must have tried this earlier and this problem has a solution but I just couldn't figure it out. Can you please help me out? Thank you in advance. -- Raju R.N. Third Year, B.Tech Mechanical Engineering National Institute of Technology Karnataka, Surathkal

4 5

Failure With DockPrep
by Dylan J. Bennett 10 Jul '12

10 Jul '12

Hi, I am attempting to run DockPrep on NQO2 which contains an FAD cofactor. Everything works until it attempts to add charges to FAD at which point it returns an error message. If I delete FAD it will return the same error message for the Zn ion. It seems to be unable to add charges for any non-amino acid molecules. I am running the latest stable build of Chimera. Interestingly, I know Chimera used to be able to calculate these charges with an old version I had but seems no longer able. Below is the reply log. Thank you. #0, chain A: nrh dehydrogenase [quinone] 2 #0, chain B: nrh dehydrogenase [quinone] 2 No incomplete side chains Terminii for WT_noH.pdb (#0) chain A determined from SEQRES records Terminii for WT_noH.pdb (#0) chain B determined from SEQRES records Chain-initial residues that are actual N terminii: ALA 1.A, ALA 1.B Chain-initial residues that are not actual N terminii: Chain-final residues that are actual C terminii: GLN 230.A, GLN 230.B Chain-final residues that are not actual C terminii: 482 hydrogen bonds Hydrogens added Charge model: AMBER ff99SB Assigning partial charges to residue ZN (net charge +2) with am1-bcc method Assigning partial charges to residue FAD (net charge +0) with am1-bcc method Running ANTECHAMBER command: C:/Program Files/Chimera 1.6.2/bin/amber11/bin\antechamber -ek qm_theory='AM1', -i c:\docume~1\dylan_~1\locals~1\temp\tmpy6za6o\ante.in.mol2 -fi mol2 -o c:\docume~1\dylan_~1\locals~1\temp\tmpy6za6o\ante.out.mol2 -fo mol2 -c bcc -nc 0 -j 5 -s 2 (FAD) (FAD) (FAD) Total number of electrons: 407; net charge: 0 (FAD) INFO: Number of electrons is odd: 407 (FAD) Please check the total charge (-nc flag) and spin multiplicity (-m flag) (FAD) (FAD) Running: "C:/Program Files/Chimera 1.6.2/bin/amber11/bin/sqm" -O -i sqm.in -o sqm.out (FAD) Error: cannot run ""C:/Program Files/Chimera 1.6.2/bin/amber11/bin/sqm" -O -i sqm.in -o sqm.out" of bcc() in charge.c properly, exit (FAD) Running: "C:/Program Files/Chimera 1.6.2/bin/amber11/bin/bondtype" -j part -i ANTECHAMBER_BOND_TYPE.AC0 -o ANTECHAMBER_BOND_TYPE.AC -f ac (FAD) (FAD) Running: "C:/Program Files/Chimera 1.6.2/bin/amber11/bin/atomtype" -i ANTECHAMBER_AC.AC0 -o ANTECHAMBER_AC.AC -p gaff Failure running ANTECHAMBER for residue FAD Check reply log for details -- -Dylan J. Bennett Dylan.John.Bennett(a)Gmail.com (914) 621-1149

2 1

Programming within Chimera
by Mario Dejung 10 Jul '12

10 Jul '12

Hi all, is there an easy way to test and develop programs within Chimera? I always write python scripts and open these in Chimera… Would be much easier to have something like idle or similar to develop scripts and test them. Or is there a better way I did not found? Looking forward to any suggestions. Kind regards Mario

3 5

(no subject)
by Khalil Raja Howard 10 Jul '12

10 Jul '12

Vv bb n8bv. Mvv vtbv t. B b7bn. B'v vb v v 7iv vt. B bv Sent from my Samsung Epic™ 4G Touch

1 0

chimera1.6.1 model panel
by MARY VARUGHESE 10 Jul '12

10 Jul '12

Hi, I have installed the chimera1.6.1 in ubuntu 64 bit. Installation successful. But in the model panel tool only the 'activate all' button is working. although added to the favourite list all other function buttons are not working. Do anyone know how to sort out this problem. Also do anyone know the correct usage of savesphgen command when used in the command line tool of chimera. Thanking you Mary Varughese

2 1

Android download
by Frank Irby 09 Jul '12

09 Jul '12

Hello I love using chimera I just upgraded my mac to 10.5.8. But I can't get past the python script for downloading chimera-1.6.2-mac.dmg I agree to the terms of use..... If you could email me a download link... That would be awsome.. Thanks Frank http://mandelscape.deviantart.com/gallery/ http://dreamscape.myartsonline.com/ Sent from Yahoo! Mail on Android

2 1

AMBER99SB
by Nikolay Igorovich Rodionov 09 Jul '12

09 Jul '12

Hi all, I just have a quick question. Is AMBER99SB a fixed charge or polarizable forcefield? Thank you, Nikolay Rodionov

2 6

Raytracing with clip planes
by Tom Goddard 09 Jul '12

09 Jul '12

Hi Ed, File / Save Image... with raytracing enabled correctly handles both the near clip plane and per-model clip planes in Chimera 1.6.1 and 1.6.2. Probably you are using an older Chimera release. I know at some point in the past the raytraced image saving did not handle clip planes. Tom > Hi, > When I use POV ray tracing in Chimera, it appears to ignore a > clipping plane (the rendered image is unclipped). Is there any way > around this? > Regards, > Ed

2 1

Scripting headless Chimera
by Evans, Mark 06 Jul '12

06 Jul '12

Hello, I am doing some epitope analysis and I am generating images of each potential epitope overlaid and colored on the antigen model. I have a script that loops through a list of residue sets (epitopes) and uses chimera to generate the images. The script works if I call it from within Chimera running on Mac OSX. I just installed the headless version on Redhat linux and was trying to modify my python script to run on the headless version and I ran into a few issues I would like some advice with. 1. Say I have ten sets of residues, which should produce 10 images. I get the first one, but then I get the following error: Traceback (most recent call last): File "/opt/bin/Chimera64-1.6.2rc/share/chimeraInit.py", line 686, in init midas_text.doRunScript("runscript", script) File "/opt/bin/Chimera64-1.6.2rc/share/Midas/midas_text.py", line 2037, in doRunScript execfile(scriptPath, scriptGlobals) File "batchEpitopeModel3.py", line 144, in <module> callChimera(data[ab][4],data[ab][5],fn,dn) File "batchEpitopeModel3.py", line 29, in callChimera rc("open " + trimer) File "/opt/bin/Chimera64-1.6.2rc/share/chimera/__init__.py", line 2426, in runCommand makeCommand(*args, **kw) File "/opt/bin/Chimera64-1.6.2rc/share/Midas/midas_text.py", line 69, in makeCommand f(c, args) File "/opt/bin/Chimera64-1.6.2rc/share/Midas/midas_text.py", line 1427, in doOpen modelArg, noprefs) File "<string>", line 1, in <module> File "/opt/bin/Chimera64-1.6.2rc/share/Midas/__init__.py", line 1937, in open raise MidasError('%s' % msg) MidasError: No such file or directory Error while processing 'batchEpitopeModel3.py': MidasError: No such file or directory File "/opt/bin/Chimera64-1.6.2rc/share/Midas/__init__.py", line 1937, in open raise MidasError('%s' % msg) It seems like Chimera terminated my script, even though it should be executing a loop. 2. The images that are generated on the Mac are large, hi-res pngs, but the images generated by the headless version are very small, low-res versions. I am not setting any image dimensions, are the defaults different between the two versions? Thanks for any help. I can post (or email directly) part of my python code if that is helpful. -Mark -This e-mail and any attachments may contain CONFIDENTIAL information, including PROTECTED HEALTH INFORMATION. If you are not the intended recipient, any use or disclosure of this information is STRICTLY PROHIBITED; you are requested to delete this e-mail and any attachments, notify the sender immediately, and notify the LabCorp Privacy Officer at privacyofficer(a)labcorp.com or call (877) 23-HIPAA / (877) 234-4722.

3 2

Surface rendering
by George Tzotzos 06 Jul '12

06 Jul '12

Hi everybody, I'm using SiteComp to detect differences in binding affinities between two similar structures. The _clusters.pdb file produced by SiteComp is a standard PDB file in which the grid points corresponding to the difference clusters are represented by hydrogen atoms. They can be treated as any molecule in Chimera. Usually I find it useful to represent them as a mesh surface. Usually, I load in Chimera the protein.pdb, the ligand.pdb and the _clusters.pdb. After this, I select the _clusters.pdb and show it as mesh or solid using Actions-> Surface. In some cases, I fail to render the surface, or to be precise only one part of the clusters is rendered. I understand that this is a frequent problem with this type of discontinuous pdb. I'm attaching one such file and I would be grateful for any help Best regards George

3 4

Generating binaries in Chimera Python
by Raju Purohit 06 Jul '12

06 Jul '12

Hello, I am working on SWIG which converts the functions written in C and C++ into their python equivalent which would be later used in Chimera. At one point while building binaries, I received an error message saying *extensions must be built with a compiler than can generate compatible binaries. Visual Studio 2003 was not found on this system.* So I believe installing Visual Studio 2003 must help building binaries. But since I will be actually working on Chimera Python, I wanted to know which compiler can generate compatible binaries in Chimera Python? Shall I go ahead with Visual Studio 2003? or any other version? Thank you in advance. -- Raju R.N. Third Year, B.Tech Mechanical Engineering National Institute of Technology Karnataka, Surathkal

2 1

how to use the command of "savepos" and "scene"
by Qinfen Zhang 05 Jul '12

05 Jul '12

Dear All I'd like to use the commond "savepos" or "scene" to save the maps' rotations and translations relative to input coordinates, etc., but when I used the command: ~savepos ****(a name I write) , or ~scene ***** There are errors reminder:No position named *****, or No scene named **** The versions I have tried include 1.6.1-linux_x86_64 and 1.6.2-linux_x86_64. Both of them have same problems. Could you kindly tell me how to use the savepos or scene, or how to resolve my problems? Millions thanks Qinfen ************************************************ （Qinfen Zhang）（Ph.D） Bio.EM.Lab,School of Life Science, Zhongshan（Sun Yat－sen） University Guangzhou, 510275,P.R.China Tel:86-020-84112286(Lab) http://scholar.google.com/citations?user=Wj62cPoAAAAJ&hl=en http://sklbc.sysu.edu.cn/Team/User/info.aspx?typeid=283&pid=80 http://bioem.sysu.edu.cn ************************************************

2 5

Re: [Chimera-users] question about surface properties in Chimera
by Elaine Meng 05 Jul '12

05 Jul '12

Hi Katie, The hydrophobicity coloring in the presets menu is simply using the Kyte-Doolittle amino acid hydrophobicity values. That is, all the surface patches belonging to a given amino acid residue type will have the same color, and the colors range from blue for the most hydrophilic through white to orange-red for the most hydrophobic. If you open Render By Attribute (under Tools... Structure Analysis) and set it to show the attribute of "residues" named "kdHydrophobicity" you can apply a different coloring scheme to these same values. Or, if you want, you can write out a file that lists the residues in the protein and the associated values (in that tool's menu, use File... Save Attributes). That will include all the residues, though, not just the ones on the surface. <http://www.cgl.ucsf.edu/chimera/docs/ContributedSoftware/render/render.html…> However, as mentioned, it is merely a lookup based on the residue type. There is a table of Kyte-Doolittle hydrophobicity values here, and instructions for using different scales of amino acid hydrophobicity, if you would like: <http://www.cgl.ucsf.edu/chimera/docs/UsersGuide/midas/hydrophob.html> We encourage Chimera questions to be sent to chimera-users(a)cgl.ucsf.edu (Cc'd) unless the message includes private data. I hope this helps, Elaine ----- Elaine C. Meng, Ph.D. UCSF Computer Graphics Lab (Chimera team) and Babbitt Lab Department of Pharmaceutical Chemistry University of California, San Francisco On Jul 4, 2012, at 7:40 AM, Katherine Klymko wrote: > Dear Dr. Meng, > Hello--I am a theoretical chemistry student at Columbia University and I am interested in the hydrophobicity maps of proteins that Chimera generates: I know that this can be used to visualize the hydrophobicity of the surface, but does it also generate a file that I can use that lists the positions of the surface atoms or amino acids with their hydrophobic value? I am interested in quantitatively comparing the hydrophobic surface organization in a large number of proteins. > > I apologize if you are the wrong person to ask but when searching for solutions on line, you seemed to be the person that a lot of people went to for help. > Thank you, > Katie Klymko

2 2

just a word of appreciation
by Reut S. Abramovich 05 Jul '12

05 Jul '12

Hi, Just wanted to say i have been using chimera for the last 6 years or so, and enjoy it very much. I hope you will continue to improve this magnificent scientific tool - its doing a great job in balancing a logical, easy to use, user interface and providing the user with a lot of impressive capabilities, which i can run on my laptop (and thats important !!). I really think Chimera team should be congratulated not only on content and code writing, but also on project management. All the best ! -- Kind Regards, Reut S. Abramovich PhD candidate Australian Centre for Astrobiology University of New South Wales Room G13, Biological Sciences Building Kensington, NSW 2052, Australia Phone: (+61) 02 9385 2098 Cell: (+61) 0406 858 646

2 1

Error when exporting to obj format
by Vicente Díaz 05 Jul '12

05 Jul '12

Hi: I am trying to export a scene to obj format. I have tried this export with two different versions of chimera (1.5.3 and 1.6.1), and tried to open the resulting file in two different 3d programs: Cinema 4D and 3d studio max. Although both applications recognize the exported file, when they open it they dont find any content. In C4D, the file is an empty scene, while importer in 3ds max sends an error message telling that there are no objects to import. Therefore, it seems that the file is empty. I have seen that this kind exporting in Chimera is too fast (almost instantly) when compared to exporting to other file formats, like vrml, which take some time but work perfectly. Is there something I am doing wrong or an option I havent noticed to ensure export to obj file format? Thank you in advance, Vicente

4 4

Beta-turns and hairpins
by Kyle Morris 03 Jul '12

03 Jul '12

Dear all, Is there a simple way to model beta-turns and hairpins in polypeptide chains in Chimera? Thanks in advance for any assistance, Kyle

3 2

User Inquiry
by Yen Bui 02 Jul '12

02 Jul '12

To whom this may concern, I’m an undergraduate student doing some research at KSTATE this summer and I’ve been assigned to work on a project that utilizes Chimera. My professor is unavailable a lot of the time and I’ve been struggling a bit with a problem. I’ve been successful at opening up the following PDB files: 1DHK 1DPX 1HYL 2CAU 3BLG 1OA6 1JBC 1OA5 I’m able to open up the .pdb files, proceed to use the commands “del solvent” and “del @ .b” in the command line. I’m also able to go to ToolsàHigher Order Structure à Crystal Contacts before changing the contact distance from 1.0 to 4.0 and check mark the create copies of contacting molecules. However when I attempt to do the following actions for the rest of the proteins I run into a variety of issues: For example 2CAU: When I attempt to “measure buried area #0 # 2-7,” I get the following response in my reply log: #0, chain A: JACK BEAN vicilin 6 pairs of NCS asymmetric units of 2CAU contact at distance 1.0 A Atoms MTRIX SMTRY Unit cell MTRIXref Copies 1 0 4 0 0 0 0 1 1 0 5 0 0 0 0 1 1 0 6 -1 0 -1 0 1 1 0 8 0 0 0 0 1 1 0 9 0 0 -1 0 1 1 0 11 0 0 -1 0 1 C:\Program Files\Chimera 1.6.1\bin\mscalc.exe 1.400000 2.000000 1 MSMSLIB 1.3 started on Local PC Copyright M.F. Sanner (March 2000) Compilation flags C:\Program Files\Chimera 1.6.1\bin\mscalc.exe 1.400000 2.000000 1 MSMSLIB 1.3 started on Local PC Copyright M.F. Sanner (March 2000) Compilation flags C:\Program Files\Chimera 1.6.1\bin\mscalc.exe 1.400000 2.000000 1 MSMSLIB 1.3 started on Local PC Copyright M.F. Sanner (March 2000) Compilation flags C:\Program Files\Chimera 1.6.1\bin\mscalc.exe 1.400000 2.000000 0 MSMSLIB 1.3 started on Local PC Copyright M.F. Sanner (March 2000) Compilation flags C:\Program Files\Chimera 1.6.1\bin\mscalc.exe 1.400000 2.000000 0 MSMSLIB 1.3 started on Local PC Copyright M.F. Sanner (March 2000) Compilation flags C:\Program Files\Chimera 1.6.1\bin\mscalc.exe 1.400000 2.000000 0 MSMSLIB 1.3 started on Local PC Copyright M.F. Sanner (March 2000) Compilation flags C:\Program Files\Chimera 1.6.1\bin\mscalc.exe 1.400000 2.000000 0 MSMSLIB 1.3 started on Local PC Copyright M.F. Sanner (March 2000) Compilation flags [End of Reply Log] So I’m not able to get back the calculations I want. Also, when I attempt to use the Surface Analysis à Attributes Calculator to run the following function : sum(atom.buriedSASArea) and check the “Restrict formula domain to current selection, if any” and “Save calculation results to file,” after selecting the “C” atoms I get the reply: Formula evaluation error: expecting vector argument in function Is there something I need to do before I attempt these actions? Also, I have very little experience with programs in general (I’m a chemistry major/upcoming experimental chemist working with theortical physicist…a little out of my element). Thanks in advance, -Yen Bui

2 3

Alignment of symmetry axes via Chimera
by danashah＠post.tau.ac.il 02 Jul '12

02 Jul '12

Hi all, I've only joined this mailing list lately, so pardon me if this question was asked and answered before. We have two different peptides, each contains a 4-fold symmetry axis. We would like to align those two symmetry axes, without superimpose one peptide on the other, since they should be continuous. Is there a way to do that via Chimera (gui or no gui)? I was able to find this conversation: http://www.cgl.ucsf.edu/pipermail/chimera-users/2008-October/003140.html but it doesn't solve our specific situation. Best, Dana. __ Dana Sachayni Joel Hirsch's Lab Faculty of Life Sciences Tel Aviv University Ramat Aviv, Israel e-mail: danashah(a)post.tau.ac.il

2 1

Wrong formtting into pdb file after "Chimera"
by Hsih-Te Yang 29 Jun '12

29 Jun '12

Hello: By using "Chimera" under its environment, I retrieved the 3GBM from internet of PDB. Then "H" and "L" chains were selected and then combined into one model. The formats before and after using Chimera are different: Before and download from PDB: original 3GBM.pdb: -------------------------------------------------------------------------- ATOM 8198 N ILE H 52 21.400 -46.642 -15.670 1.00 34.21 N ATOM 8199 CA ILE H 52 21.907 -48.031 -15.705 1.00 34.50 C ATOM 8200 C ILE H 52 22.650 -48.325 -17.003 1.00 34.35 C ATOM 8201 O ILE H 52 22.192 -47.956 -18.089 1.00 34.71 O ATOM 8202 CB ILE H 52 20.781 -49.070 -15.662 1.00 34.67 C ATOM 8203 CG1 ILE H 52 19.817 -48.868 -14.495 1.00 35.26 C ATOM 8204 CG2 ILE H 52 21.375 -50.440 -15.579 1.00 36.91 C ATOM 8205 CD1 ILE H 52 20.481 -48.373 -13.235 1.00 36.77 C ATOM 8206 N PRO H 52A 23.772 -49.033 -16.926 1.00 34.41 N ATOM 8207 CA PRO H 52A 24.505 -49.283 -18.185 1.00 34.55 C ATOM 8208 C PRO H 52A 23.750 -50.255 -19.109 1.00 34.33 C ATOM 8209 O PRO H 52A 22.874 -51.013 -18.645 1.00 34.29 O ATOM 8210 CB PRO H 52A 25.817 -49.905 -17.709 1.00 34.19 C ATOM 8211 CG PRO H 52A 25.402 -50.687 -16.528 1.00 35.46 C ATOM 8212 CD PRO H 52A 24.336 -49.808 -15.815 1.00 34.63 C -------------------------------------------------------------------------- After using Chimera and saved as ".pdb" file: -------------------------------------------------------------------------- ATOM 371 N ILE H 52 -61.722 -45.711 -51.406 1.00 34.21 N ATOM 372 CA ILE H 52 -62.988 -46.402 -51.737 1.00 34.50 C ATOM 373 C ILE H 52 -63.058 -46.767 -53.215 1.00 34.35 C ATOM 374 O ILE H 52 -62.716 -45.957 -54.082 1.00 34.71 O ATOM 375 CB ILE H 52 -64.219 -45.520 -51.499 1.00 34.67 C ATOM 376 CG1 ILE H 52 -64.272 -44.923 -50.094 1.00 35.26 C ATOM 377 CG2 ILE H 52 -65.457 -46.324 -51.739 1.00 36.91 C ATOM 378 CD1 ILE H 52 -63.739 -45.839 -49.022 1.00 36.77 C ATOM 379 N PRO H 52 -63.548 -47.961 -53.533 1.00 34.41 N ATOM 380 CA PRO H 52 -63.580 -48.321 -54.966 1.00 34.55 C ATOM 381 C PRO H 52 -64.618 -47.494 -55.747 1.00 34.33 C ATOM 382 O PRO H 52 -65.552 -46.927 -55.145 1.00 34.29 O ATOM 383 CB PRO H 52 -63.975 -49.797 -54.948 1.00 34.19 C ATOM 384 CG PRO H 52 -64.891 -49.879 -53.793 1.00 35.46 C ATOM 385 CD PRO H 52 -64.271 -48.943 -52.718 1.00 34.63 C -------------------------------------------------------------------------- The "52A" -> "52", there is no discrimination between "ILE" and "PRO" on the position 52 of H chain. Please let me know, what wrong with my data processing? Thank you a lot. Hsih-Te

2 2

Untranslating after using solvate
by Matthew Baumgartner 29 Jun '12

29 Jun '12

Hello, I am using chimera to add a shell of water around a given protein using the solvate command through the command line. However, upon adding solvent, the protein is translated/rotated a bit, as mentioned in the documentation ( file:///opt/UCSF/Chimera64-1.6/share/chimera/helpdir/ContributedSoftware/solvate/solvate.html <cid:part1.03060408.05020907@pitt.edu>). However, I would like to leave the protein in it's input coordinates and simply add waters around it. Is there a way to use the solvate command without translation? If not, how should I go about resetting the structure back to it's original coordinates? Thanks, Matt Probably unnecessary details: Running: USCF Chimera, production version 1.6 (build 35700) Under: Ubuntu 12.04 64-bit

2 2

Chimera registration
by Sébastien POMEL 28 Jun '12

28 Jun '12

Hi, I tried to register because my registration has expired but when I enter my informations it says that I have to enter my last name first, and then my first name. I did not make any mistake but it keeps saying this. Could you help me? Thank you Sébastien Pomel Sébastien POMEL, Ph.D. Antiparasitic Chemotherapy Group UMR CNRS 8076, Faculty of Pharmacy, University PARIS XI, 5 rue Jean-Baptiste Clément, 92296, CHATENAY-MALABRY CEDEX FRANCE Tel : +33 (0)1-46-83-52-84 Fax : +33 (0)1-46-83-55-57

2 1

Phases of the 3D FFT
by Denis Chrétien 28 Jun '12

28 Jun '12

Dear all, I'm new to this list, so maybe this question has been raised previously. Sorry if this is the case. We are using the capability of Chimera to perform 3D Fourier transforms, in order to analyse the effect of the missing wedge on cryo-electron tomograms of microtubules. The "layer lines" of the microtubules are nicely revealed in 3D, showing rings corresponding to the amplitudes of their FFT. Yet, it would be really nice to have the phases displayed, e.g. using colors. Would that be possible to be implemented into the "vop Fourier" command of Chimera? Best, Denis ___________________________ Université de Rennes 1 UMR 6290, équipe TIPs Campus de Beaulieu, Bât. 13 35042 Rennes Cedex France Tel. +33 (0)2 23 23 67 64 http://equipes.igdr.univ-rennes1.fr/fr/tips/ ___________________________

2 1

Clustering docking results using "headless" Chimera
by Hurt, Darrell (NIH/NIAID) [E] 28 Jun '12

28 Jun '12

Hi there, I want to use Chimera on a server (or in an automated fashion by command line; "-nogui") to read in a bunch (1000s) of PDB structures (each having an identical number of atoms) and then do clustering using the NMRCLUST code that you've so conveniently adapted. I found this old thread: http://www.cgl.ucsf.edu/pipermail/chimera-users/2008-October/003193.html Is this still the preferred method for doing what I'm hoping? Also, is it possible to do a MatchMaker alignment before the clustering? Thanks, Darrell -- Darrell Hurt, Ph.D. Section Head, Computational Biology Bioinformatics and Computational Biosciences Branch (BCBB) OCICB/OSMO/OD/NIAID/NIH 31 Center Drive, Room 3B62B, MSC 2135 Bethesda, MD 20892-2135 Office 301-402-0095 Mobile 301-758-3559 http://bioinformatics.niaid.nih.gov<http://bioinformatics.niaid.nih.gov/> (Within NIH) http://exon.niaid.nih.gov<http://exon.niaid.nih.gov/> (Public) Disclaimer: The information in this e-mail and any of its attachments is confidential and may contain sensitive information. It should not be used by anyone who is not the original intended recipient. If you have received this e-mail in error please inform the sender and delete it from your mailbox or any other storage devices. National Institute of Allergy and Infectious Diseases shall not accept liability for any statements made that are sender's own and not expressly made on behalf of the NIAID by one of its representatives.

2 4

change movie frame directory
by Trina Manalo 28 Jun '12

28 Jun '12

Hi all, We're having problems changing the directory where movie frames are saved to a separate drive (We installed Chimera on an SSD with limited space). In the movierecorder dialog box, we added Additional recording options: directory E:\Chimera_frames Additional encoding options: resetMode keep And got the following error: MidasError: Directory E:\Chimera_frames does not exist File "E:\Chimera 2012-06-28\share\MovieRecorder\moviecmd.py", line 84, in record_op raise CommandError('Directory %s does not exist' % (directory,)) Any advice? -Trina

2 1

Cannot open the .pdb file generated from ZDOCK
by Hsih-Te Yang 27 Jun '12

27 Jun '12

Good morning, all: Attached is the output file generated by "ZDOCK". I couldn't open it by "Chimera", but "RasMol" was working. What wrong with this? Any comment and reply are greatly appreciated. Hsih-Te Yang

2 2

atom type labels ?
by Marek Maly 26 Jun '12

26 Jun '12

Hello, is there any way how to obtain atom-type labels when loading molecular structure using *.prmtop and *.inpcrd/*.rst/*.mdcrd Amber files ? These atom types are indeed available in *.prmtop file, but I didn't know how to visualize them in Chimera. I was hoping to find this possibility under "Actions->Label->other..." but I didn't find this item on the actual list. Thanks in advance for any comment ! Best wishes, Marek -- Tato zpráva byla vytvořena převratným poštovním klientem Opery: http://www.opera.com/mail/

2 1

Electrostatic potential
by George Tzotzos 26 Jun '12

26 Jun '12

Hi everybody, Assuming that one knows the precise residues constituting a binding site, it is possible to calculate the electrostatic potential of these residues only? If yes, how? Thanks for any advice George

5 7

Peptide Optimization
by Gustavo Souza 22 Jun '12

22 Jun '12

Hello! has anybody has a clue for a method to optimize a peptide structure (12 aa) using Chimera? thanks for help! Gus.

2 1

help with how to save a volumes
by Sara Sandin 20 Jun '12

20 Jun '12

Hi, Thank you for a great software :) I have one problem. I have two em density maps in spider format. After I have used the fit in map option and one density has been rotated and shifted, how do I save a new spider file with the applied rotation and translation? Thank you, Sara -- Division of Structural Studies MRC Laboratory of Molecular Biology Hills Road Cambridge CB2 0QH UK ssandin(a)mrc-lmb.cam.ac.uk

2 2

stick scale
by FABRE, BENJAMIN 19 Jun '12

19 Jun '12

Helo, I am a new user of chimera. I would to change the stick scale of a single residue of one protein. How can I do this? Should I create different models to do this? Thank you. Benjamin Fabre

2 2

Need help for using Chimera
by A-A_lowie li 18 Jun '12

18 Jun '12

Dear Sir: I am a new user of Chimera, but immediately attracted by this handy software Chimera. Since my model requires a lot of computation time in energy minimization, could you please how to set up the environment for parallel computation of energy minimization in Chimera? On one website, it was said, MMTK ENERGY THREADS could be reset for parallel computation. After installation of MMTK, I am confused on how to change parameter in MMTK, and recompile Chimera (or change Chimera settings ). Could you please give me more details about how to set MMTK ENERGY THREADS in Chimera? Sincerely thanks for your advice. Lowie -- Without dream, life is incomplete!

2 4

Re: [Chimera-users] Chimera movie
by Elaine Meng 18 Jun '12

18 Jun '12

On Jun 18, 2012, at 3:40 PM, Vladimir Kuznetsov wrote: > Hi Elaine, > I'm trying to make a movie using Chimera. The basic outline is as follows: a homo-dimer is dissociating into monomers, then focus on one of the monomers rearranging into a compact form. I think I could record the dissociation step with "savepos/fly" option, and morphing works for the second step. Is it possible to stitch them together for a single QuickTime file? > Thank you for your time, > Vlad Kuznetsov > (Sacchettini lab, Texas A&M University) Hi Vlad, Instead of combining two movie files into one movie file (it must be possible, but I don't have experience with that), I would just do everything in one Chimera movie content script. You could either do the savepos and morphing in the same or a different script before starting recording, or do it interactively and save the session. Then restore session if you had saved a session, and execute your recording script, in which you can use fly and other movement commands (move, turn, ...) as well as the coordset command to play the morph. <http://www.cgl.ucsf.edu/chimera/docs/UsersGuide/movies.html> There is an example movie and associated Chimera script in the Animation Gallery, see "Ball-and-socket motion" currently the 6th one down: <http://www.cgl.ucsf.edu/chimera/animations/animations.html> I cc'd chimera-users(a)cgl.ucsf.edu since this answer might help others (it's generally better to send questions there than to me directly, unless you are including private data). Good luck with making a beautiful movie! I hope this helps, Elaine ---------- Elaine C. Meng, Ph.D. UCSF Computer Graphics Lab (Chimera team) and Babbitt Lab Department of Pharmaceutical Chemistry University of California, San Francisco

1 0

Measuring Beta Barrels
by Danielle L'Heureux 18 Jun '12

18 Jun '12

Hi - We are using Chimera to analyze fluorescent proteins, and we want to cluster and compare the barrels of each protein by examining a cross section of the FP beta barrel. Is there a way to measure the ellipsoid shape of a "slice" of a protein? Or is there a way to create an elliptical plane from which we can then calculate the area? Thank you, Danielle L'Heureux

3 2

Chimera System Requirments: Details Solicited
by sunny kumar 14 Jun '12

14 Jun '12

Hi All, I have been trying to figure out the system requirments before installing Chimera, on my laptop. Would request you to please share the minimum processor speed, RAM, OS and hard-disk requirments for optimum results on chimera-1.6.1-win32.exe. I am currently using an HP laptop with XP Operating System, Intel Core 2 Duo Processor, 1 GB RAM and 60 GB hard-disk. Thanks for the help. Regards, Sunny Kumar

3 2

Re: [Chimera-users] Ellipsoids for 800 pdbs
by Elaine Meng 14 Jun '12

14 Jun '12

On Jun 14, 2012, at 4:54 AM, mselvaraj(a)mbu.iisc.ernet.in wrote: > Dear Meng, > I need to calculate ellipsoid axis for some 800 pdbs that I have in a > directory using measur inertia command. I was trying to load one by one and > calcualte, but I was huge. I read about python script for running in > batches. Is there any chimera script for doing this?. I would like to get > your help in doing this. Thanks in advance. > > Yours sincerely, > M. Selvaraj, > Graduate student, > Molecular Biophysics Unit, > Indian Institute of Science, > Bangalore 560 012. Dear M. Selvaraj, The Chimera Programmer's Guide includes a primer on how to write a python script to process multiple structures: <http://www.cgl.ucsf.edu/chimera/docs/ProgrammersGuide/basicPrimer.html> It is better to send Chimera questions to chimera-users(a)cgl.ucsf.edu (or if advanced programming issues, to chimera-dev(a)cgl.ucsf.edu) instead of to me directly. I hope this helps, Elaine ---------- Elaine C. Meng, Ph.D. UCSF Computer Graphics Lab (Chimera team) and Babbitt Lab Department of Pharmaceutical Chemistry University of California, San Francisco

1 0

addH: Weird results
by George Tzotzos 11 Jun '12

11 Jun '12

Hi everybody, For several months I have been saving docking results from Autodock, adding hydrogens and submitting them to Amber for molecular dynamics. Chimera worked perfectly well. A typical result is attached as <file1.pdb>. I repeated the process with a different pose of the same ligand and got very weird results. In fact the atoms were numbered differently and some atoms were not numbered at all, or rather they were given ***. I submitted some of the original ligands, that is the ligands to which Chimera added Hs correctly. A typical example is attached <docking.result_8_2.pdb>. The result of <file1.pdb> was not reproduced. The errors described above were repeated (see <file2.pdb>). Trying to renumber the atoms according to <file1.pdb> did not help. I am a bit baffled by this. Any help will be most welcome. Best regards George PS. The submitted ligand is bisabolol.

2 3

TER characters between residues in exported PDB ?
by Marek Maly 07 Jun '12

07 Jun '12

Hello all, I would like to know if there is any way how to export from Chimera molecular structure in PDB format but with TER string between all residues in the file. This would be very helpful if one prepares in Chimera PDB inputs (containing also non protein or non DNA/RNA molecules) for Amber because Amber (Leap) automatically tries to create bonds between all consecutive residues unless they are separated by TER string. Thank you very much for any useful information. Best wishes, Marek -- Tato zpráva byla vytvořena převratným poštovním klientem Opery: http://www.opera.com/mail/

3 11

error in add chain ID
by Hamzeh, Rahimi 07 Jun '12

07 Jun '12

Dear Eric use I want rename_pdb_for_chimera.py for adding chain ID to pdb file but i got following erro. buksanbio@hamzeh:/media/6C166CAD166C7A4A/kit/zdock/apc10-apc3$ python rename_pdb_for_chimera.py 1 avgapc10final.pdb File "rename_pdb_for_chimera.py", line 100 there's a chain identifier in the "TER" line... (the condition len ^ IndentationError: expected an indented block Please let me know about my wrong best wish

2 1

Re: [Chimera-users] undisplay label in distance monitor
by Bala subramanian 07 Jun '12

07 Jun '12

Friends, > I have written a script to draw lines between atoms (using distance > monitor). I dnt want the distance label to be displayed with the pseudo > bond. Kindly write me the way to remove the label. My script is below. > > model=chimera.openModels.open('myavg.pdb') > res=model[0].residues > MAT=loadtxt('mymatrix',dtype=float) > chimera.runCommand('focus') > for x in range(len(res)): > for y in range(len(res)): > if x <> y : > value=MAT[x,y] > > if 0.5 < value > 0.75: > > b=distanceMonitor.newPseudoBond(res[x].atomsMap['CA'][0],res[y].atomsMap['CA'][0]) > b.drawMode=1 > b.radius=0.05 > #b.label=None I tried keeping this value as None and empty > string but it doesnt help. > b.color=getColorByName('red') > > else: pass > > else: continue > > Thanks, Bala -- C. Balasubramanian

2 3

index out of range
by Francesco Pietra 06 Jun '12

06 Jun '12

Running movie for prmtop/dcd proved extremely slow at amd64, finally showing the protein in a water box, albeit offering very limited analysis. Error message: index out of range, error processing "monitor changes". The log is 16MB!, below the startr and end of the log: MDTools 1.2 Exp (2005-08-20) by James Phillips. Trajectory.DCD.MDToolsMarch97.md.help() for more info. HomoCoord 1.3 Exp (2005-08-20) - Constants 1.1 Exp (2004-05-17) - AtomGroup 1.4 Exp (2007-02-07) - local 1.1 Exp (2004-05-17) Unknown OSTYPE ??? set. Viewing and plotting are disabled. - Trans 1.2 Exp (2005-08-20) - DCD 1.10 Exp (2007-02-07) - Data 1.2 Exp (2005-08-20) using memory mapping REMARKS FILENAME=./heat-01.dcd CREATED BY NAMD REMARKS DATE: 06/03/12 CREATED BY USER: francesco Model 0 (heat-01.dcd) appears to be a protein without secondary structure assignments. Automatically computing assignments using 'ksdssp' and parameter values: energy cutoff -0.5 minimum helix length 3 minimum strand length 3 Use command 'help ksdssp' for more information. Traceback (most recent call last): File "/usr/local/chimera_Nov3.2011/share/chimera/triggerSet.py", line 83, in invoke self._funcData, triggerData) File "/usr/local/chimera_Nov3.2011/share/chimera/Sequence.py", line 1161, in _cacheCheck if len(kids) == molecule.rootForAtom(kids[0], IndexError: list index out of range Error processing trigger "monitor changes": .................................... .................................... Traceback (most recent call last): File "/usr/local/chimera_Nov3.2011/share/chimera/triggerSet.py", line 83, in invoke self._funcData, triggerData) File "/usr/local/chimera_Nov3.2011/share/chimera/Sequence.py", line 1161, in _cacheCheck if len(kids) == molecule.rootForAtom(kids[0], IndexError: list index out of range Error processing trigger "monitor changes": IndexError: list index out of range File "/usr/local/chimera_Nov3.2011/share/chimera/Sequence.py", line 1161, in _cacheCheck if len(kids) == molecule.rootForAtom(kids[0], See reply log for Python traceback. Thanks for the attention francesco pietra

2 2

transparency for surface in intersurf
by Jean-Didier Maréchal 06 Jun '12

06 Jun '12

Hi guys, is there a way to change the transparency of intersurf objects? I'd like to have the surface not hiden all the object in behing one given view. thanks a lot, cheers jd Dr. Jean-Didier Maréchal Lecturer The Computational Biotechnological Chemistry Team Unitat de Química Física Departament de Química Universitat Autònoma de Barcelona Edifici C.n. 08193 Cerdanyola (Barcelona) Tel: +34.935814936 e-mail: JeanDidier.Marechal(a)uab.es www: http://asklipio.qf.uab.es

2 2

fitmap
by Hernando J Sosa 05 Jun '12

05 Jun '12

HI, What is the correct syntax to run the fitmap command?. I have a pdb structure named C1 and a density map (spider format) named MV (names as appear in the Model panel). If I try in the command line: fitmap C1 MV I get the error: fitmap invalid volume argument "MV" What am I doing wrong? Thanks

3 5

Fwd: ESP calculations
by Eric Pettersen 05 Jun '12

05 Jun '12

Begin forwarded message: > From: Nikolay Igorovich Rodionov <nirodion(a)syr.edu> > Date: May 21, 2012 12:43:34 PM PDT > To: Eric Pettersen <pett(a)cgl.ucsf.edu> > Subject: RE: [Chimera-users] ESP calculations > > Thank you both, > > Can either of you tell me how the information in a volume data set > is organized? I am looking at a .dx file that I created using APBS > which I would assume to be very similar to the volumetric data sets > created by Chimera. What does each column of data represent? Is > there any way for me to sort the ESP data based on position using > Excel or Matlab? I am only concerned with ESP data for one region of > molecule. If you could point me in the direction of some good > documentation on this file type it would be great. I don't know, so I'm forwarding this out to chimera-users land, where someone might have an answer... --Eric > > Thanks again, > Nikolay Rodionov > > -----Original Message----- > From: Eric Pettersen [mailto:pett@cgl.ucsf.edu] > Sent: Monday, May 21, 2012 2:57 PM > To: chimera-users(a)cgl.ucsf.edu BB > Cc: Nikolay Igorovich Rodionov > Subject: Re: [Chimera-users] ESP calculations > > Also, if you compute a volume, you can use the "Values at Atom > Positions" tool to, um, get the values at atom positions (say, a > ligand), if that's relevant to what you're doing. > > --Eric > > On May 21, 2012, at 9:09 AM, Elaine Meng wrote: > >> Hi Nikolay, >> You can generate a grid of values with the "Compute grid" option of >> Coulombic Surface Coloring (or corresponding option of the >> "coulombic" >> command). The grid is a volume data set, and when it is generated >> the >> Volume Viewer and Surface Color dialogs will automatically appear. >> >> <http://www.cgl.ucsf.edu/chimera/docs/ContributedSoftware/coulombic/ >> co >> ulombic.html >>> >> <http://www.cgl.ucsf.edu/chimera/docs/ContributedSoftware/coulombic/ >> co >> ulombic.html#volume >>> >> >> You can save the grid to a file with the FIle menu of Volume Viewer. >> <http://www.cgl.ucsf.edu/chimera/docs/ContributedSoftware/ >> volumeviewer >> /framevolumeviewer.html >>> >> >> As for the values at each point of the surface, I don't know of a way >> to write these all to a file, but in Surface Color if you click the >> Options button and then turn on the option to "Report value at mouse >> position" it will report the values in the status line at the bottom >> of the Chimera window when you click into the graphics window and >> then >> mouse over the surface. I just noticed that to make this work it is >> necessary to recolor the surface first by clicking the Color button >> on >> this dialog, which may be a bug, but that's the workaround! >> <http://www.cgl.ucsf.edu/chimera/docs/ContributedSoftware/surfcolor/ >> su >> rfcolor.html >>> >> >> If you have the grid file saved you can reopen it in Chimera later >> and >> use it in Surface Color without rerunning the ESP calculation. >> >> However, keep in mind that Coulombic ESP is more for qualitative >> purposes of visualization or making comparisons between related >> structures than for absolute quantitative accuracy. For example, you >> could easily make all the ESP values half as large simply by doubling >> the dielectric constant used in their calculation, as shown in the >> equation in the Coulombic Surface Coloring manual page. >> >> I hope this helps, >> Elaine >> ---------- >> Elaine C. Meng, Ph.D. >> UCSF Computer Graphics Lab (Chimera team) and Babbitt Lab Department >> of Pharmaceutical Chemistry University of California, San Francisco >> >> On May 21, 2012, at 8:05 AM, Nikolay Igorovich Rodionov wrote: >> >>> Hi all, >>> I was wondering if there was a way to get an output data file >>> regarding ESP coloring and calculations based on Coulomb's law. The >>> visualization is great but I would also like to quantify the data. >>> Thank you, >>> Nikolay Rodionov >> >> >> _______________________________________________ >> Chimera-users mailing list >> Chimera-users(a)cgl.ucsf.edu >> http://plato.cgl.ucsf.edu/mailman/listinfo/chimera-users >> > > > >

3 2

ESP calculations
by Nikolay Igorovich Rodionov 05 Jun '12

05 Jun '12

Hi all, I was wondering if there was a way to get an output data file regarding ESP coloring and calculations based on Coulomb's law. The visualization is great but I would also like to quantify the data. Thank you, Nikolay Rodionov

4 3

Question about animated Ramachandran plot
by Trina Manalo 04 Jun '12

04 Jun '12

Hello, I would like to create an animated Ramachandran plot using an MD trajectory. One approach I've considered is using a per-frame script to save Ramachandran plot images (i.e., using the model panel, its possible to create a plot and then save the image as a png) Is there a way to do this using commands? Or is there an easier way to animate a plot of phi and psi angles over time? Thank you very much, Trina

2 1

triggering events when findhbond finds a bond
by Anne Bowen 04 Jun '12

04 Jun '12

Hi, I currently have a "Per-Frame Command" set up (in the MD Movie dialog) that finds the H bonds (findhbond makePseudobonds true lineWidth 2.0 color green intramodel true intermodel false selRestrict any) every frame of a trajectory. Whenever a hbond is detected, I would like to turn the entire structure a different color just for that frame, and then have it go back to being colored by heteroatom. Is there an easy way to accomplish this? I tried to look through the documentation to determine if "findhbond" could return true or false if an h bond was found and it did not seem like it was possible. Is the only way to do this to change the findhbond script itself? Any help or suggestions is greatly appreciated! Thank you, Anne

2 1

bond transparency as a function of length?
by Kersey Black 04 Jun '12

04 Jun '12

Hi, Very recent to Chimera. Trying to set the transparency of a bond to be a function of bond length in each frame of a trajectory. I have figured out how to define a transparent color, and now I am imaging the solution might use something like range color to vary the blending of the opaque version of the color and the fully transparent version based on distance, with the distance being determined as a per frame attribute of those atoms, but someplace around here I am lost. Any hints, links or suggestions would be very much appreciated. Cheers, KB

2 3

Re: [Chimera-users] [chimera-dev] Rotating about an axis with mouse
by Elaine Meng 04 Jun '12

04 Jun '12

Hi Patrick, If I understand correctly, you can do what you want with "Constrained Move" (in menu under Tools... Movement): <http://www.cgl.ucsf.edu/chimera/docs/ContributedSoftware/constrained/constr…> (The purpose of "Movement Mouse Mode" is different, mainly to allow moving subparts of a model. By default, mouse manipulation moves whole models.) You can also specify center and axis of rotation if using commands (turn, roll). <http://www.cgl.ucsf.edu/chimera/docs/UsersGuide/midas/turn.html> <http://www.cgl.ucsf.edu/chimera/docs/UsersGuide/midas/roll.html> I hope this helps, Elaine ---------- Elaine C. Meng, Ph.D. UCSF Computer Graphics Lab (Chimera team) and Babbitt Lab Department of Pharmaceutical Chemistry University of California, San Francisco On Jun 4, 2012, at 6:28 AM, ladam wrote: > Hi all, > I have a python script that allows me to rotate a residue in a molecule > of a desired angle around a predefined vector. > Now I'd like to be able to do this graphically with the mouse on a selected > residue. > I have almost found what I want if I use the 'Move selection' option in the > 'Movement Mouse mode' but this does rotate around the center of Mass or > geometric center, not around a vector. > What I plan to do is derive the code from the corresponding /share/MoveSelection/move.py > module and try to insert a vector instead of the center_of_rotation(self.movable_groups) > but there is maybe a better, simpler idea. > Any suggestion? > Thanks a lot > -------------------------------- > Patrick Ladam > Maître de Conférence > Université Paris 13 - UFR SMBH > CSPBAT - Service RMN > 74, rue Marcel Cachin > 93017 Bobigny Cedex > Tel: 01 48 38 73 25 > Fax: 01 48 38 77 77 > mail: ladam(a)smbh.univ-paris13.fr > -------------------------------

1 0

make selection disappear smoothly
by Thomas Evangelidis 01 Jun '12

01 Jun '12

Dear Chimera developers, Simple question: is there any way to make a selection disappear smoothly during a movie? Thanks, Thomas

2 1

copy & paste multiple commands
by Thomas Evangelidis 01 Jun '12

01 Jun '12

Dear Chimera developers, This is an elementary question, but after searching a while in the mailing list and the documentation, I couldn't find the answer. So the question is if it is possible to copy & paste multiple commands in a single line into the Chimera command line interface. Alternatively, is the any "end of line" character that designates the end a of one command and the start of the next one? Thanks in advance, Thomas

2 1

pH based conformational change
by Nikolay Igorovich Rodionov 01 Jun '12

01 Jun '12

Hi all, Is there any way in Chimera to model protein denaturation across various pH values? Thanks Nikolay Rodionv

2 1

Re: [Chimera-users] Interpreting field / force direction in Coulombic Surface Coloring
by Elaine Meng 01 Jun '12

01 Jun '12

Hi Sumitro, The interaction energy of a "test" charge at some point would be the charge multiplied by the electrostatic potential. So if the test charge is -1 e (like one electron) its interaction energy at a point with potential +10 kcal/(mol.e) would be favorable, -10 kcal/mol. Positive potential favors interaction with negative charges and vice versa. I hope this clarifies, Elaine ----- Elaine C. Meng, Ph.D. UCSF Computer Graphics Lab (Chimera team) and Babbitt Lab Department of Pharmaceutical Chemistry University of California, San Francisco P.S. better to send questions to chimera-users(a)cgl.ucsf.edu because if you send to me and I'm on vacation, you might not get answered On May 18, 2012, at 12:36 AM, Sumitro Harjanto wrote: > Hi Elaine, > I have a simple question regarding the Coulombic Surface Coloring. I understand that the potential are generated by assuming a charged probe that moves along the surface of the model and as it traverses the surface the potential is picked up as the calculated electrostatic force the probe should experience (that's my understanding, correct me if I'm wrong please). > > I am just, however, a little confused about the interpretation of the value. say if I got a blue patch on the surface, which means I'm getting values in the range of ~10 (positive) kcal/(mol·e) at 298 K; does that mean the region indicated by the blue patch should potential attract or repel electron? > Thanks! > Cheers, > Sumitro

3 6

Visualization of terminal carboxylate
by George Tzotzos 26 May '12

26 May '12

This must be really trivial but I am asking nevertheless as I tried to no avail. I'm trying to visualise the terminal carboxylate oxygens. For example, I do: select :125@O :125@OXT and get 2 atoms selected. I then try to Actions Atoms/Bonds sphere. Nothing is shown. I would be grateful for any suggestions Regards George

2 1

PubChem Online Compound Search and Download
by Nancy 25 May '12

25 May '12

Hi All, I have been using the PubChem database to search for uncharged small molecules. However, even after specifying zero charge, PubChem still outputs compounds containing amino groups (-NH2) and carboxylic acids (-COOH); since I am interested in physiological pH, these compounds would actually be charged. Is there some way to exclude molecules containing these functional groups? I've noticed that there is an option on PubChem to include only certain atoms, but the search times out at 2 minutes if I try this. I'd like to exclude halogens and aldehydes as well, can this be specified? Finally, after searching for numerous compounds, how could all of them be downloaded into an organized compound library? If there is another online compound database besides PubChem that can be easily searched and has the same or better functionality, I'd greatly appreciate any info about it. Thanks, Nancy

2 2

water around protein
by Bala subramanian 25 May '12

25 May '12

Friends, I guess when i select no. of water as "sel ::WAT & protein z<3", i the distance of water is chosen as distance from atom protein atom centres. Instead i want to calculate no. of water around the protein Vdw surface with same distance value. Any idea would be of great help. Thanks, Bala

2 1

Re: [Chimera-users] Chimera-users Digest, Vol 109, Issue 28
by Boaz Shaanan 24 May '12

24 May '12

Hi, In answer to Nikolay's question about ESP values in various positions: 1) Elaine is absolutely right in pointing you to the APBS bb. If you look in their FAQ you'll notice that the question has been addressed several times. 2) There is an 'atompot' command that you can use when you run apbs. It'll print the values for each atom in the pdb, the only problem is that last time I tried it there were no atom names in output which was difficult for me (apbs team were supposed to add that feature) but x,y.z were there. 3) If atompot is not what you need somebody in the abps team will surely help you. Cheers, Boaz Boaz Shaanan, Ph.D. Dept. of Life Sciences Ben-Gurion University of the Negev Beer-Sheva 84105 Israel E-mail: bshaanan(a)bgu.ac.il Phone: 972-8-647-2220 Skype: boaz.shaanan Fax: 972-8-647-2992 or 972-8-646-1710 ________________________________________ From: chimera-users-bounces(a)cgl.ucsf.edu [chimera-users-bounces(a)cgl.ucsf.edu] on behalf of chimera-users-request(a)cgl.ucsf.edu [chimera-users-request(a)cgl.ucsf.edu] Sent: Thursday, May 24, 2012 10:00 PM To: chimera-users(a)cgl.ucsf.edu Subject: Chimera-users Digest, Vol 109, Issue 28 Send Chimera-users mailing list submissions to chimera-users(a)cgl.ucsf.edu To subscribe or unsubscribe via the World Wide Web, visit http://plato.cgl.ucsf.edu/mailman/listinfo/chimera-users or, via email, send a message with subject or body 'help' to chimera-users-request(a)cgl.ucsf.edu You can reach the person managing the list at chimera-users-owner(a)cgl.ucsf.edu When replying, please edit your Subject line so it is more specific than "Re: Contents of Chimera-users digest..." Today's Topics: 1. Fwd: ESP calculations (Eric Pettersen) 2. APBS output format (Elaine Meng) 3. Hydrogen bond energy calculation (Aditya Padhi) 4. Re: Hydrogen bond energy calculation (Elaine Meng) ---------------------------------------------------------------------- Message: 1 Date: Wed, 23 May 2012 13:18:14 -0700 From: Eric Pettersen <pett(a)cgl.ucsf.edu> To: "chimera-users(a)cgl.ucsf.edu BB" <chimera-users(a)cgl.ucsf.edu> Subject: [Chimera-users] Fwd: ESP calculations Message-ID: <4C557064-D2EC-45A5-9523-B35E683C76D5(a)cgl.ucsf.edu> Content-Type: text/plain; charset="us-ascii"; Format="flowed"; DelSp="yes" Begin forwarded message: > From: Nikolay Igorovich Rodionov <nirodion(a)syr.edu> > Date: May 21, 2012 12:43:34 PM PDT > To: Eric Pettersen <pett(a)cgl.ucsf.edu> > Subject: RE: [Chimera-users] ESP calculations > > Thank you both, > > Can either of you tell me how the information in a volume data set > is organized? I am looking at a .dx file that I created using APBS > which I would assume to be very similar to the volumetric data sets > created by Chimera. What does each column of data represent? Is > there any way for me to sort the ESP data based on position using > Excel or Matlab? I am only concerned with ESP data for one region of > molecule. If you could point me in the direction of some good > documentation on this file type it would be great. I don't know, so I'm forwarding this out to chimera-users land, where someone might have an answer... --Eric > > Thanks again, > Nikolay Rodionov > > -----Original Message----- > From: Eric Pettersen [mailto:pett@cgl.ucsf.edu] > Sent: Monday, May 21, 2012 2:57 PM > To: chimera-users(a)cgl.ucsf.edu BB > Cc: Nikolay Igorovich Rodionov > Subject: Re: [Chimera-users] ESP calculations > > Also, if you compute a volume, you can use the "Values at Atom > Positions" tool to, um, get the values at atom positions (say, a > ligand), if that's relevant to what you're doing. > > --Eric > > On May 21, 2012, at 9:09 AM, Elaine Meng wrote: > >> Hi Nikolay, >> You can generate a grid of values with the "Compute grid" option of >> Coulombic Surface Coloring (or corresponding option of the >> "coulombic" >> command). The grid is a volume data set, and when it is generated >> the >> Volume Viewer and Surface Color dialogs will automatically appear. >> >> <http://www.cgl.ucsf.edu/chimera/docs/ContributedSoftware/coulombic/ >> co >> ulombic.html >>> >> <http://www.cgl.ucsf.edu/chimera/docs/ContributedSoftware/coulombic/ >> co >> ulombic.html#volume >>> >> >> You can save the grid to a file with the FIle menu of Volume Viewer. >> <http://www.cgl.ucsf.edu/chimera/docs/ContributedSoftware/ >> volumeviewer >> /framevolumeviewer.html >>> >> >> As for the values at each point of the surface, I don't know of a way >> to write these all to a file, but in Surface Color if you click the >> Options button and then turn on the option to "Report value at mouse >> position" it will report the values in the status line at the bottom >> of the Chimera window when you click into the graphics window and >> then >> mouse over the surface. I just noticed that to make this work it is >> necessary to recolor the surface first by clicking the Color button >> on >> this dialog, which may be a bug, but that's the workaround! >> <http://www.cgl.ucsf.edu/chimera/docs/ContributedSoftware/surfcolor/ >> su >> rfcolor.html >>> >> >> If you have the grid file saved you can reopen it in Chimera later >> and >> use it in Surface Color without rerunning the ESP calculation. >> >> However, keep in mind that Coulombic ESP is more for qualitative >> purposes of visualization or making comparisons between related >> structures than for absolute quantitative accuracy. For example, you >> could easily make all the ESP values half as large simply by doubling >> the dielectric constant used in their calculation, as shown in the >> equation in the Coulombic Surface Coloring manual page. >> >> I hope this helps, >> Elaine >> ---------- >> Elaine C. Meng, Ph.D. >> UCSF Computer Graphics Lab (Chimera team) and Babbitt Lab Department >> of Pharmaceutical Chemistry University of California, San Francisco >> >> On May 21, 2012, at 8:05 AM, Nikolay Igorovich Rodionov wrote: >> >>> Hi all, >>> I was wondering if there was a way to get an output data file >>> regarding ESP coloring and calculations based on Coulomb's law. The >>> visualization is great but I would also like to quantify the data. >>> Thank you, >>> Nikolay Rodionov >> >> >> _______________________________________________ >> Chimera-users mailing list >> Chimera-users(a)cgl.ucsf.edu >> http://plato.cgl.ucsf.edu/mailman/listinfo/chimera-users >> > > > >

1 0

Hydrogen bond energy calculation
by Aditya Padhi 24 May '12

24 May '12

Dear Chimera users, I want to calculate the "energy or force" exerted between amino acid residues interacted by Hydrogen bonds throughout a total trajectory from MD simulation of a protein performed using Amber 10. (Example: H-bond between Isoleucine17-Asp15, Asp15-Ile46, Ile46-His13 etc, I want to calculate the H-bond interaction energy between these pair of residues and hence the net energy). I searched in the tutorials and literature but could not able to find any appropriate solutions. If anyone has the idea, please assist me finding the solution of this problem. Thanking you, Regards Aditya.

2 1

How to change the style of Hbonds
by Wendy Chu 20 May '12

20 May '12

Hello all, I am doing the Hbond analysis for my investigation. I found that the Hbonds are labeled as the solid line in the Chimera. But I prefer the dashed line. How to change it? Thank you~~~ -- Wen-Ting Chu State Key Laboratory of Theoretical and Computational Chemistry, Institute of Theoretical Chemistry, Jilin University, Changchun 130023, P. R. China

2 2

In Silico Compound Library Search
by Nancy 19 May '12

19 May '12

Hi All, Does anyone know of a free cheminformatic service from which it's possible to narrow down a search for molecules by inputting limits on their molecular parameters, such as molecular weight or the number of hydrogen bond donors, etc? Such a resource would be of great help. Thanks in advance, Nancy

1 0

How to place a metal ion in protein model
by Suneel N.A. 18 May '12

18 May '12

Hi Its my pleasure to introduce myself, I am Suneel, graduate student from India. I am not a bioinformatician by profession but a eager aspirant of learning bioinformatics. I am new to Chimera, but as I started using it, the desire for leraning Bioinformatics increased more and more. Chimera is such an awesome tool packed with so many options. I love it . I have small question for you. I have a predicted the structure of protein using in silico tools (based on homology modeling). Literature sates that this protein binds to Magnesium. Now I would like to know if I can use chimera to place the metal in the modeled structure and prove/validate it based on metal geometry. Please do the needful. Thanking you in anticipation yours sincerely suneel -- *Suneel Narayanavari. A* Graduate Student Prof. Manjula Sritharan's Laboratory of Infection Biology Department of Animal Sciences School of Life Sciences University of Hyderabad Hyderabad-46

6 12

Minimize Structure While keeping charges
by Michael Tomasini 17 May '12

17 May '12

Hello, I was wondering if there was a way to read in charges from a .mol2 file in order to use those charges in the minimize structure utility. By default, it seems that minimize structure adds charges which can be a rather time-consuming step. If I already have the charges in a .mol2 file, can these charges simply be used for the minimization? Thanks, Mike

3 2

Re: [Chimera-users] [Dock-fans] cofactors in dock
by Scott Brozell 17 May '12

17 May '12

Hi, On Wed, May 16, 2012 at 03:22:11PM +0530, Mary Varughese wrote: > I have to include the cofactor GTP as part of my receptor protein and dock > with a ligand. But chimera is not allowing to prepare rec_charged.mol2 file > since it fails at finding amibcc charge method for GTP residue. Then i > separately prepared the mol2 file for GTP (using gtp.prep and gtp.frcmod) > and after performing dockprep on the receptor i opened the GTP.mol2 file in > the same window and write the mol2 file. but again at grid generation it > fails "Reading in coordinates of receptor. > WARNING assign_vdw_labels: Atom valence violated for 1SA0.pdb (combined) > **** GTP 848 C8 13145. > Error reading in receptor." Which version of chimera are you using ? There was some recent activity for GTP but using Gasteiger charges: http://plato.cgl.ucsf.edu/pipermail/chimera-users/2011-October/006846.html Are you saying that you ran antechamber separately from chimera and got the am1bcc charges for gtp ? scott

2 1

PDB column overlap --PDB2PQR,APBS
by Nikolay Igorovich Rodionov 17 May '12

17 May '12

Hi all, I am trying do Poisson-Boltzmann calculations through outside software, PDB2PQR and APBS. I am prepare my initial pdb file in chimera using the 'write pdb' method. The final structure is quite large, 737058 atoms, so I am getting overlaps in the data columns after I write the PDB file. This doesn't create a problem for rendering the PDB file but I get parsing errors and other strange occurrences when I try to create a complementary PQR file. Does anyone know of a work around? Here are links to my structures, if you look you will see that a significant portion of the structure is getting cut off in the PQR. I can't seem to generate more than about 99760 atoms, no matter what I try. http://dl.dropbox.com/u/42179401/2TMV.18H.pdb http://dl.dropbox.com/u/42179401/2TMV.18Ha.pqr Can anyone think of a potential fix? I've experienced this same problem with smaller helix pdb files. Thank you, Nikolay Rodionov

3 9

improved movie tools
by Martin de Jonge 16 May '12

16 May '12

Hi, I recently published a tomographic reconstruction that was rendered using Chimera (see: http://www.pnas.org/content/107/36/15676.abstract) The movie that we were able to build using Chimera was excellent, but had to be recorded entirely in real time. That is, we had to turn on recording, manipulate the model, and turn off recording. I feel that it would be much easier if there was a nice interface to sequencing functionality. In this (as I imagine it) a sequence of particular views could be stored, and times specified for smooth transition from one element in the sequence ('view') to the next. These views could even be stored as saved sessions (if that helps with implementation). Please let me know if this functionality is already possible and (if so) please send me a sample! I note that my licence has expired; but when I try to renew it I run into problems with the server. Looking forward to your reply, Martin de Jonge Senior Scientist - XFM Australian Synchrotron p: (03) 8540 4195 | f: (03) 8540 4200 | m: 0488 338 594 800 Blackburn Road, Clayton, Victoria 3168 <br>This message and any attachments may contain proprietary or confidential information. If you are not the intended recipient or you received the message in error, you must not use, copy or distribute the message. Please notify the sender immediately and destroy the original message. Thank you.

3 2

RMSD between ensemble of a protein and its paralogue crystal structure
by Thomas Evangelidis 15 May '12

15 May '12

Dear UCSF Chimera developers, I want to calculate the RMSD between a MD trajectory of a protein and the crystal structure of its paralogue protein. I have looked though the Ensemble Match and RMSD Analysis pages but these applications work for the same proteins (correct me if I am wrong). Is there any way to provide an alignment file to Chimera and calculate the time series of the RMSD between the two paralogues? Thanks in advance, Thomas -- ====================================================================== Thomas Evangelidis PhD student Biomedical Research Foundation, Academy of Athens 4 Soranou Ephessiou , 115 27 Athens, Greece email: tevang(a)bioacademy.gr tevang3(a)gmail.com website: https://sites.google.com/site/thomasevangelidishomepage/

2 1

Addition of phosphates to PDB structures
by Donado, Carlos 14 May '12

14 May '12

Hi all, I would like to learn how to add a phosphate group to a particular residue, resembling phosphorylation of a particular residue, to a PDB structure. If this is doable using Chimera I would really appreciate any hints on how to do this. Also, I am new to Chimera but I was wondering if there was a way of adding ATP to a designated ATP binding site. I would very much appreciate any responses, Thanks, Carlos Donado The information in this e-mail is intended only for the person to whom it is addressed. If you believe this e-mail was sent to you in error and the e-mail contains patient information, please contact the Partners Compliance HelpLine at http://www.partners.org/complianceline . If the e-mail was sent to you in error but does not contain patient information, please contact the sender and properly dispose of the e-mail.

4 8

Re: [Chimera-users] semi-transparent ribbon behind semi-transparent surface
by Tom Goddard 14 May '12

14 May '12

Hi Sumitro, I made an image in the style of your image (1a0m.jpg below) using Chimera 1.6.1 and I think it captures the effect of your Chimera 1.5 image (ep.png) very well. The difference is that in your image where the ribbon crosses itself you can sometimes see through the top ribbon. Actually the top ribbon is only transparent in your image in about half of the crossings due to a Chimera 1.5 ribbon transparency bug. In the Chimera 1.6.1 image the ribbon is fully opaque so you do not see through it at places where it crosses itself. I think this produces a better image with less visual depth confusion. Also I think adding silhouette edges as I did in 1a0m_edges.jpg below improves the perception of ribbon crossovers further. I think the main virtue of your image is that the ribbon that is further back is lighter in color so it draws less attention. That is achieved by depth cueing which is the same in Chimera 1.6 and 1.5. My image perhaps does not illustrate depth cueing as well as yours since I used a different PDB model (didn't have yours) and in my view it doesn't vary as much in depth. Tom -------- Original Message -------- Subject: Re: [Chimera-users] semi-transparent ribbon behind semi-transparent surface Date: Sun, 13 May 2012 18:19:39 +0800 From: Sumitro Harjanto To: Tom Goddard Hi Tom, I've attached an image, it's something like this, can you view it? thanks! cheers, Sumitro On 12 May 2012 00:58, Tom Goddardwrote: Hi Sumitro, It is hard to completely understand your problem without seeing an example image made with Chimera 1.5 using the technique you described. If you provide such an image we might have suggestions about how to make something very similar in the latest Chimera. The image link you send before gives permission denied. Tom > Hi Elaine, > > thanks for the reply. I believe you exactly described what I did > with this paragraph: > "In Chimera 1.5 each surface could have its own single-layer > transparency. Thus you could still have multiple transparent > layers overall, but only the top layer of each surface. I'm > guessing the image is something like that (I don't have permission > to view it)." > Sadly, I resorted to re-installing CHIMERA 1.5 cos even if I use > pastel colours in Chimera 1.6, the effects were far from what I've > got using the multiple-single layer transparency previously. Is > there any plan to make the transparency setting more customisable > in the future? that will be of great help! thanks! > > Cheers, > Sum > > On 4 May 2012 00:18, Elaine Meng wrote: > > > On May 3, 2012, at 8:05 AM, Sumitro Harjanto wrote: > > > Hi Elaine, > > I used to use CHIMERA 1.5 to generate some molecular images. > and I was able to show a "hint of shadow" of ribbon behind a > semitransparent molecular surface. but I realised that I can > no longer do that from Chimera 1.6 onwards. I have tried > fiddling with the new "single layer transparency" value, but > either option did not provide me with the visual effect that I > could previously get in chimera 1.5. when I turned off the > single layer transparency, the molecular surface became very > messy with multiple shades and the color is visibly darker. > but If I leave it on, the semi-transparent ribbon was not > displayed at all. is there anyway that I can achieve a similar > effect in Chimera 1.6? i.e if you're wondering what effect I > am talking about here is an example: > http://onlinelibrary.wiley.com/store/10.1002/emmm.201200213/asset/image_n/n… > <http://onlinelibrary.wiley.com/store/10.1002/emmm.201200213/asset/image_n/n…> > > Thanks, Elaine! > > Cheers, > > Sumitro > > Hi Sumitro! > In Chimera 1.5 each surface could have its own single-layer > transparency. Thus you could still have multiple transparent > layers overall, but only the top layer of each surface. I'm > guessing the image is something like that (I don't have > permission to view it). > > In Chimera 1.6 the choices are only either a single layer of > transparency, or all transparent layers. > > In Chimera 1.5 if you turn off single-layer transparency for > each surface, the result is the same as in Chimera 1.6 if you > turn off global single-layer transparency. However, I realize > that does not help, since you don't want to show all layers > (it's often ugly, as you describe). > > I don't know if there is any way to get exactly what you had > before, but in 1.6 I suggest trying this: use single-layer > transparency (which is the default), make only the surface > transparent, keep the ribbon opaque. If you want the ribbon > to be less bold, try making it a pastel color. > > I am not involved in the graphics programming -- I CC'd the > list since the other developers may have suggestions (and > other users might find the discussion informative). > I hope this helps, > Elaine > ---------- > Elaine C. Meng, Ph.D. > UCSF Computer Graphics Lab (Chimera team) and Babbitt Lab > Department of Pharmaceutical Chemistry > University of California, San Francisco > >

1 1

Surface atoms and charges
by Nikolay Igorovich Rodionov 14 May '12

14 May '12

Hi all, I was wondering if any of you knew of a way to determine exactly what atoms occur on the surface of a molecule or how to get the exact charge at a point on a surface. Thank you, Nikolay Rodionov

2 1

AMBER ff99SB Documentation
by Nikolay Igorovich Rodionov 12 May '12

12 May '12

Hi all, Could someone point in the direction of some good documentation on ff99SB, how it functions, and what calculations it performs? Thank you, Nikolay Rodionov

2 1

Using Chimera from non-chimera python scripts
by Dan Cohen 11 May '12

11 May '12

Hello, I would like to use Chimera python classes from a python script running outside Chimera (part of a larger python project). I saw another post that explained that this could be done but I was unclear which of the Chimera functionality can be used in this case. In case I want to create an image (e.g. load pdb files, do some editing and then create an image to a file) - can I use the "chimera" class or do I need to use something else? (I saw a reference to "midas" classes) Is there an example for doing that? Processing a file and creating an image in a non-GUI scenario running outside chimera? Thank you, Dany

3 3

Re: [Chimera-users] semi-transparent ribbon behind semi-transparent surface
by Elaine Meng 11 May '12

11 May '12

On May 3, 2012, at 8:05 AM, Sumitro Harjanto wrote: > Hi Elaine, > I used to use CHIMERA 1.5 to generate some molecular images. and I was able to show a "hint of shadow" of ribbon behind a semitransparent molecular surface. but I realised that I can no longer do that from Chimera 1.6 onwards. I have tried fiddling with the new "single layer transparency" value, but either option did not provide me with the visual effect that I could previously get in chimera 1.5. when I turned off the single layer transparency, the molecular surface became very messy with multiple shades and the color is visibly darker. but If I leave it on, the semi-transparent ribbon was not displayed at all. is there anyway that I can achieve a similar effect in Chimera 1.6? i.e if you're wondering what effect I am talking about here is an example: http://onlinelibrary.wiley.com/store/10.1002/emmm.201200213/asset/image_n/n… > Thanks, Elaine! > Cheers, > Sumitro Hi Sumitro! In Chimera 1.5 each surface could have its own single-layer transparency. Thus you could still have multiple transparent layers overall, but only the top layer of each surface. I'm guessing the image is something like that (I don't have permission to view it). In Chimera 1.6 the choices are only either a single layer of transparency, or all transparent layers. In Chimera 1.5 if you turn off single-layer transparency for each surface, the result is the same as in Chimera 1.6 if you turn off global single-layer transparency. However, I realize that does not help, since you don't want to show all layers (it's often ugly, as you describe). I don't know if there is any way to get exactly what you had before, but in 1.6 I suggest trying this: use single-layer transparency (which is the default), make only the surface transparent, keep the ribbon opaque. If you want the ribbon to be less bold, try making it a pastel color. I am not involved in the graphics programming -- I CC'd the list since the other developers may have suggestions (and other users might find the discussion informative). I hope this helps, Elaine ---------- Elaine C. Meng, Ph.D. UCSF Computer Graphics Lab (Chimera team) and Babbitt Lab Department of Pharmaceutical Chemistry University of California, San Francisco

3 3

Partial Charge and Electrostatic Potential Maps
by Nikolay Igorovich Rodionov 10 May '12

10 May '12

Hi Everyone, I was wondering if there is a way to create a maps of partial charge and electrostatic potential that I could then overlay on top of a similar structure. The biological assembly I am working with is too large for good surface calculations so I would like to overlay these maps on the surface of a condensed structure that only includes the regions I am concentrating on. Thank you, Nikolay Rodionov

3 2